Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0809692778:

Variant ID: vg0809692778 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 9692778
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.62, C: 0.38, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:


GTTTTGTGTCCCCCTCACTACAGTGCTCCTTCTTCTACCTCTGGACAGAGCCGAGCTCTCCAGCCCGTGCACAGTTGCCGCCGCCTCCTCCTTCCAAATC[T/C]
GGCCTCCCCGTTGCTCCTCTTTCCAAATTAGTTGCGGGAATGGAATCCTATCAATCTCCTCTTCCTTTTCCCCAAGAAATCCCCAAAAGTTTCTATAGGA

Reverse complement sequence

TCCTATAGAAACTTTTGGGGATTTCTTGGGGAAAAGGAAGAGGAGATTGATAGGATTCCATTCCCGCAACTAATTTGGAAAGAGGAGCAACGGGGAGGCC[A/G]
GATTTGGAAGGAGGAGGCGGCGGCAACTGTGCACGGGCTGGAGAGCTCGGCTCTGTCCAGAGGTAGAAGAAGGAGCACTGTAGTGAGGGGGACACAAAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.10% 21.40% 1.27% 15.17% NA
All Indica  2759 83.20% 4.90% 0.36% 11.53% NA
All Japonica  1512 29.40% 55.70% 0.53% 14.42% NA
Aus  269 45.70% 1.90% 2.60% 49.81% NA
Indica I  595 87.40% 12.60% 0.00% 0.00% NA
Indica II  465 58.10% 4.30% 1.08% 36.56% NA
Indica III  913 91.60% 0.50% 0.44% 7.45% NA
Indica Intermediate  786 85.20% 4.50% 0.13% 10.18% NA
Temperate Japonica  767 4.30% 91.40% 0.39% 3.91% NA
Tropical Japonica  504 55.60% 12.90% 0.40% 31.15% NA
Japonica Intermediate  241 54.40% 31.50% 1.24% 12.86% NA
VI/Aromatic  96 22.90% 3.10% 33.33% 40.62% NA
Intermediate  90 57.80% 30.00% 3.33% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0809692778 T -> C LOC_Os08g15920.1 5_prime_UTR_variant ; 3774.0bp to feature; MODIFIER silent_mutation Average:57.872; most accessible tissue: Zhenshan97 young leaf, score: 97.823 N N N N
vg0809692778 T -> C LOC_Os08g15900.1 downstream_gene_variant ; 2765.0bp to feature; MODIFIER silent_mutation Average:57.872; most accessible tissue: Zhenshan97 young leaf, score: 97.823 N N N N
vg0809692778 T -> C LOC_Os08g15910.1 downstream_gene_variant ; 237.0bp to feature; MODIFIER silent_mutation Average:57.872; most accessible tissue: Zhenshan97 young leaf, score: 97.823 N N N N
vg0809692778 T -> DEL N N silent_mutation Average:57.872; most accessible tissue: Zhenshan97 young leaf, score: 97.823 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0809692778 T C 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0809692778 NA 1.46E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809692778 NA 4.40E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809692778 NA 3.85E-08 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809692778 NA 2.19E-06 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809692778 NA 3.16E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809692778 NA 7.67E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809692778 NA 6.46E-07 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809692778 NA 5.02E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809692778 NA 7.89E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809692778 NA 3.26E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809692778 NA 2.09E-08 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809692778 NA 6.59E-09 mr1521_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809692778 NA 7.82E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809692778 NA 2.12E-06 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809692778 NA 4.22E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809692778 NA 7.02E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809692778 NA 6.82E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809692778 NA 1.10E-08 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809692778 NA 1.64E-10 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809692778 NA 6.36E-10 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809692778 NA 9.76E-15 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809692778 NA 1.83E-08 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809692778 NA 3.00E-06 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809692778 NA 4.27E-09 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809692778 NA 1.75E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251