Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0809657271:

Variant ID: vg0809657271 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 9657271
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:

ACAGCTACCACTACTGATGGACATCATCGTCTTCCGTCGCCGACTGGTTATGCCGCCGCCGACTAGTGCTTTTATCTTCACAACTGCGCGTCTTCACTAC[C/T]
GGTTTGCTTCTGTTGCCGCCGACTCGTGTCCACTTGATCACGGCAATGAAACTTTGTCATCATGGTGGAACGACTTCATCTTTATTATCTTCGGCACCAG

Reverse complement sequence

CTGGTGCCGAAGATAATAAAGATGAAGTCGTTCCACCATGATGACAAAGTTTCATTGCCGTGATCAAGTGGACACGAGTCGGCGGCAACAGAAGCAAACC[G/A]
GTAGTGAAGACGCGCAGTTGTGAAGATAAAAGCACTAGTCGGCGGCGGCATAACCAGTCGGCGACGGAAGACGATGATGTCCATCAGTAGTGGTAGCTGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.10%	15.50%	1.80%	4.55%	NA
All Indica	2759	76.50%	20.80%	0.51%	2.17%	NA
All Japonica	1512	85.60%	0.50%	4.10%	9.85%	NA
Aus	269	46.10%	53.50%	0.00%	0.37%	NA
Indica I	595	95.50%	3.40%	0.17%	1.01%	NA
Indica II	465	64.70%	34.40%	0.22%	0.65%	NA
Indica III	913	72.00%	23.90%	0.55%	3.61%	NA
Indica Intermediate	786	74.30%	22.50%	0.89%	2.29%	NA
Temperate Japonica	767	90.50%	0.30%	1.17%	8.08%	NA
Tropical Japonica	504	76.20%	0.80%	9.33%	13.69%	NA
Japonica Intermediate	241	89.60%	0.40%	2.49%	7.47%	NA
VI/Aromatic	96	90.60%	2.10%	5.21%	2.08%	NA
Intermediate	90	85.60%	6.70%	4.44%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0809657271	C -> T	LOC_Os08g15870.1	upstream_gene_variant ; 4348.0bp to feature; MODIFIER	silent_mutation	Average:49.801; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg0809657271	C -> T	LOC_Os08g15870-LOC_Os08g15880	intergenic_region ; MODIFIER	silent_mutation	Average:49.801; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg0809657271	C -> DEL	N	N	silent_mutation	Average:49.801; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0809657271	NA	2.86E-07	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809657271	NA	1.13E-07	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809657271	3.31E-06	2.88E-08	mr1075	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809657271	NA	3.63E-06	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809657271	NA	2.89E-07	mr1124	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809657271	NA	9.07E-08	mr1202	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809657271	NA	1.02E-07	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809657271	NA	1.49E-07	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809657271	NA	1.29E-07	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809657271	NA	2.19E-08	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809657271	NA	9.80E-06	mr1098_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809657271	NA	1.20E-06	mr1099_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809657271	NA	8.46E-11	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809657271	NA	1.11E-06	mr1222_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251