\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0809640950:

Variant ID: vg0809640950 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 9640950
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.78, C: 0.19, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:


ATGGTAACTTGCTACTCCCTCTATTTCATATTATAAGTCATTTGACTTTTTTTCTTAGTCAAACTTTTTTAAGTTTGACCAAGTTTATAAAAAAATTTAG[T/C]
AACATCTAAAATATCAAATTAGTTTCATTAAATCTAACATTAATATATGAGAAAATTCCTTGTGTACACCTCAAAACTCTCTCAATCCCTTCTATGCACC

Reverse complement sequence

GGTGCATAGAAGGGATTGAGAGAGTTTTGAGGTGTACACAAGGAATTTTCTCATATATTAATGTTAGATTTAATGAAACTAATTTGATATTTTAGATGTT[A/G]
CTAAATTTTTTTATAAACTTGGTCAAACTTAAAAAAGTTTGACTAAGAAAAAAAGTCAAATGACTTATAATATGAAATAGAGGGAGTAGCAAGTTACCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.00% 13.10% 0.23% 44.63% NA
All Indica  2759 29.40% 4.00% 0.29% 66.36% NA
All Japonica  1512 59.50% 32.40% 0.00% 8.13% NA
Aus  269 54.30% 0.40% 0.00% 45.35% NA
Indica I  595 4.70% 12.40% 0.67% 82.18% NA
Indica II  465 51.80% 1.70% 0.43% 46.02% NA
Indica III  913 32.10% 0.30% 0.11% 67.47% NA
Indica Intermediate  786 31.60% 3.20% 0.13% 65.14% NA
Temperate Japonica  767 38.60% 57.00% 0.00% 4.43% NA
Tropical Japonica  504 86.70% 1.00% 0.00% 12.30% NA
Japonica Intermediate  241 68.90% 19.90% 0.00% 11.20% NA
VI/Aromatic  96 93.80% 0.00% 2.08% 4.17% NA
Intermediate  90 46.70% 20.00% 1.11% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0809640950 T -> C LOC_Os08g15840-LOC_Os08g15860 intergenic_region ; MODIFIER silent_mutation Average:27.611; most accessible tissue: Callus, score: 58.811 N N N N
vg0809640950 T -> DEL N N silent_mutation Average:27.611; most accessible tissue: Callus, score: 58.811 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0809640950 NA 1.30E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950 NA 6.09E-09 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950 NA 3.39E-07 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950 NA 2.46E-07 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950 NA 3.72E-06 mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950 NA 4.08E-09 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950 NA 7.36E-06 mr1140 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950 NA 1.90E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950 NA 5.39E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950 NA 3.01E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950 NA 4.07E-08 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950 NA 2.41E-08 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950 NA 8.67E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950 NA 3.43E-06 mr1592 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950 NA 8.37E-06 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950 3.06E-06 7.22E-08 mr1795 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950 NA 5.82E-08 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950 NA 5.59E-08 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950 NA 3.67E-06 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950 NA 2.30E-06 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950 NA 7.28E-07 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950 NA 5.17E-10 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950 NA 5.15E-06 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950 NA 1.79E-06 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950 NA 2.66E-06 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251