Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0809640950:

Variant ID: vg0809640950 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 9640950
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.78, C: 0.19, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:

ATGGTAACTTGCTACTCCCTCTATTTCATATTATAAGTCATTTGACTTTTTTTCTTAGTCAAACTTTTTTAAGTTTGACCAAGTTTATAAAAAAATTTAG[T/C]
AACATCTAAAATATCAAATTAGTTTCATTAAATCTAACATTAATATATGAGAAAATTCCTTGTGTACACCTCAAAACTCTCTCAATCCCTTCTATGCACC

Reverse complement sequence

GGTGCATAGAAGGGATTGAGAGAGTTTTGAGGTGTACACAAGGAATTTTCTCATATATTAATGTTAGATTTAATGAAACTAATTTGATATTTTAGATGTT[A/G]
CTAAATTTTTTTATAAACTTGGTCAAACTTAAAAAAGTTTGACTAAGAAAAAAAGTCAAATGACTTATAATATGAAATAGAGGGAGTAGCAAGTTACCAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.00%	13.10%	0.23%	44.63%	NA
All Indica	2759	29.40%	4.00%	0.29%	66.36%	NA
All Japonica	1512	59.50%	32.40%	0.00%	8.13%	NA
Aus	269	54.30%	0.40%	0.00%	45.35%	NA
Indica I	595	4.70%	12.40%	0.67%	82.18%	NA
Indica II	465	51.80%	1.70%	0.43%	46.02%	NA
Indica III	913	32.10%	0.30%	0.11%	67.47%	NA
Indica Intermediate	786	31.60%	3.20%	0.13%	65.14%	NA
Temperate Japonica	767	38.60%	57.00%	0.00%	4.43%	NA
Tropical Japonica	504	86.70%	1.00%	0.00%	12.30%	NA
Japonica Intermediate	241	68.90%	19.90%	0.00%	11.20%	NA
VI/Aromatic	96	93.80%	0.00%	2.08%	4.17%	NA
Intermediate	90	46.70%	20.00%	1.11%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0809640950	T -> C	LOC_Os08g15840-LOC_Os08g15860	intergenic_region ; MODIFIER	silent_mutation	Average:27.611; most accessible tissue: Callus, score: 58.811	N	N	N	N
vg0809640950	T -> DEL	N	N	silent_mutation	Average:27.611; most accessible tissue: Callus, score: 58.811	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0809640950	NA	1.30E-06	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950	NA	6.09E-09	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950	NA	3.39E-07	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950	NA	2.46E-07	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950	NA	3.72E-06	mr1080	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950	NA	4.08E-09	mr1124	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950	NA	7.36E-06	mr1140	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950	NA	1.90E-06	mr1149	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950	NA	5.39E-07	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950	NA	3.01E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950	NA	4.07E-08	mr1202	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950	NA	2.41E-08	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950	NA	8.67E-07	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950	NA	3.43E-06	mr1592	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950	NA	8.37E-06	mr1613	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950	3.06E-06	7.22E-08	mr1795	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950	NA	5.82E-08	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950	NA	5.59E-08	mr1962	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950	NA	3.67E-06	mr1098_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950	NA	2.30E-06	mr1099_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950	NA	7.28E-07	mr1123_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950	NA	5.17E-10	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950	NA	5.15E-06	mr1150_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950	NA	1.79E-06	mr1222_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809640950	NA	2.66E-06	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251