\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0809586152:

Variant ID: vg0809586152 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 9586152
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGACAGCCCGTCGTCGTTAAAATCGATTGACGGTGAAGCTTACAATGATTTTTTTTTTGACGAATTCATCATAGCAGTCAAGTAAGCGCAGATCTTGTTT[A/G]
GTGCGGGCGCCAGCCGTCGCCGCATCTGACTAGTCAATCAACGCAACTGTTCTCTGAAACATTATCCGGGTAGAGCCCTGGCGGAGTGTTATGTAAATAT

Reverse complement sequence

ATATTTACATAACACTCCGCCAGGGCTCTACCCGGATAATGTTTCAGAGAACAGTTGCGTTGATTGACTAGTCAGATGCGGCGACGGCTGGCGCCCGCAC[T/C]
AAACAAGATCTGCGCTTACTTGACTGCTATGATGAATTCGTCAAAAAAAAAATCATTGTAAGCTTCACCGTCAATCGATTTTAACGACGACGGGCTGTCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.30% 18.00% 1.57% 7.15% NA
All Indica  2759 88.10% 9.10% 1.01% 1.78% NA
All Japonica  1512 40.50% 37.90% 2.78% 18.78% NA
Aus  269 97.40% 2.20% 0.00% 0.37% NA
Indica I  595 84.90% 12.80% 1.85% 0.50% NA
Indica II  465 79.60% 17.80% 0.86% 1.72% NA
Indica III  913 93.00% 3.60% 0.77% 2.63% NA
Indica Intermediate  786 89.90% 7.50% 0.76% 1.78% NA
Temperate Japonica  767 7.60% 66.10% 0.26% 26.08% NA
Tropical Japonica  504 81.30% 1.40% 5.36% 11.90% NA
Japonica Intermediate  241 60.20% 24.50% 5.39% 9.96% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 71.10% 21.10% 3.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0809586152 A -> G LOC_Os08g15800.1 upstream_gene_variant ; 1190.0bp to feature; MODIFIER silent_mutation Average:50.665; most accessible tissue: Zhenshan97 young leaf, score: 65.28 N N N N
vg0809586152 A -> G LOC_Os08g15790-LOC_Os08g15800 intergenic_region ; MODIFIER silent_mutation Average:50.665; most accessible tissue: Zhenshan97 young leaf, score: 65.28 N N N N
vg0809586152 A -> DEL N N silent_mutation Average:50.665; most accessible tissue: Zhenshan97 young leaf, score: 65.28 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0809586152 A G 0.02 0.01 0.02 0.0 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0809586152 NA 3.98E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809586152 NA 2.55E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809586152 NA 6.55E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809586152 1.35E-07 3.37E-09 mr1990 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809586152 NA 9.38E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251