Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0809549221:

Variant ID: vg0809549221 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 9549221
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATGCACCAAACACCGACGTAGTTGACGTCCATCTTATCCCGACGATATATGGCGTGGAGATCTGAGAAATCTAGCCATACATAACCTTCTTCGCCGAAA[T/C]
AATCTGCCGGTGATTGAGCTGTTATATTGCCCAAGCCTTTCTTGCAGGCCTCCATGTAGAAGGTATGTAACCTTCTCATCTCCCATGGTCCTTCTTTCAG

Reverse complement sequence

CTGAAAGAAGGACCATGGGAGATGAGAAGGTTACATACCTTCTACATGGAGGCCTGCAAGAAAGGCTTGGGCAATATAACAGCTCAATCACCGGCAGATT[A/G]
TTTCGGCGAAGAAGGTTATGTATGGCTAGATTTCTCAGATCTCCACGCCATATATCGTCGGGATAAGATGGACGTCAACTACGTCGGTGTTTGGTGCATG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	15.40%	2.10%	6.90%	75.60%	NA
All Indica	2759	4.80%	1.20%	10.26%	83.69%	NA
All Japonica	1512	37.70%	4.00%	0.20%	58.07%	NA
Aus	269	0.00%	1.90%	8.92%	89.22%	NA
Indica I	595	12.90%	0.70%	4.03%	82.35%	NA
Indica II	465	3.40%	1.10%	9.46%	86.02%	NA
Indica III	913	0.50%	1.90%	14.79%	82.80%	NA
Indica Intermediate	786	4.50%	1.00%	10.18%	84.35%	NA
Temperate Japonica	767	65.40%	7.40%	0.00%	27.12%	NA
Tropical Japonica	504	2.00%	0.20%	0.60%	97.22%	NA
Japonica Intermediate	241	24.10%	1.20%	0.00%	74.69%	NA
VI/Aromatic	96	1.00%	1.00%	10.42%	87.50%	NA
Intermediate	90	24.40%	0.00%	6.67%	68.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0809549221	T -> C	LOC_Os08g15740.1	missense_variant ; p.Tyr86Cys; MODERATE	nonsynonymous_codon ; Y86C	Average:7.816; most accessible tissue: Callus, score: 22.699	probably damaging	-2.244	TOLERATED	1.00
vg0809549221	T -> DEL	LOC_Os08g15740.1	N	frameshift_variant	Average:7.816; most accessible tissue: Callus, score: 22.699	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0809549221	NA	9.14E-07	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809549221	NA	4.84E-06	mr1049_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809549221	NA	3.43E-06	mr1085_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809549221	2.90E-06	1.89E-07	mr1088_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809549221	8.50E-06	8.50E-06	mr1108_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809549221	NA	7.07E-06	mr1112_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809549221	NA	7.87E-06	mr1155_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809549221	NA	5.43E-06	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809549221	6.29E-06	3.12E-08	mr1246_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809549221	NA	7.87E-06	mr1437_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809549221	NA	4.43E-07	mr1458_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809549221	9.70E-06	9.70E-06	mr1541_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809549221	NA	1.88E-06	mr1620_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809549221	NA	2.58E-06	mr1780_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251