\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0809549221:

Variant ID: vg0809549221 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 9549221
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATGCACCAAACACCGACGTAGTTGACGTCCATCTTATCCCGACGATATATGGCGTGGAGATCTGAGAAATCTAGCCATACATAACCTTCTTCGCCGAAA[T/C]
AATCTGCCGGTGATTGAGCTGTTATATTGCCCAAGCCTTTCTTGCAGGCCTCCATGTAGAAGGTATGTAACCTTCTCATCTCCCATGGTCCTTCTTTCAG

Reverse complement sequence

CTGAAAGAAGGACCATGGGAGATGAGAAGGTTACATACCTTCTACATGGAGGCCTGCAAGAAAGGCTTGGGCAATATAACAGCTCAATCACCGGCAGATT[A/G]
TTTCGGCGAAGAAGGTTATGTATGGCTAGATTTCTCAGATCTCCACGCCATATATCGTCGGGATAAGATGGACGTCAACTACGTCGGTGTTTGGTGCATG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 15.40% 2.10% 6.90% 75.60% NA
All Indica  2759 4.80% 1.20% 10.26% 83.69% NA
All Japonica  1512 37.70% 4.00% 0.20% 58.07% NA
Aus  269 0.00% 1.90% 8.92% 89.22% NA
Indica I  595 12.90% 0.70% 4.03% 82.35% NA
Indica II  465 3.40% 1.10% 9.46% 86.02% NA
Indica III  913 0.50% 1.90% 14.79% 82.80% NA
Indica Intermediate  786 4.50% 1.00% 10.18% 84.35% NA
Temperate Japonica  767 65.40% 7.40% 0.00% 27.12% NA
Tropical Japonica  504 2.00% 0.20% 0.60% 97.22% NA
Japonica Intermediate  241 24.10% 1.20% 0.00% 74.69% NA
VI/Aromatic  96 1.00% 1.00% 10.42% 87.50% NA
Intermediate  90 24.40% 0.00% 6.67% 68.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0809549221 T -> C LOC_Os08g15740.1 missense_variant ; p.Tyr86Cys; MODERATE nonsynonymous_codon ; Y86C Average:7.816; most accessible tissue: Callus, score: 22.699 probably damaging -2.244 TOLERATED 1.00
vg0809549221 T -> DEL LOC_Os08g15740.1 N frameshift_variant Average:7.816; most accessible tissue: Callus, score: 22.699 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0809549221 NA 9.14E-07 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809549221 NA 4.84E-06 mr1049_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809549221 NA 3.43E-06 mr1085_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809549221 2.90E-06 1.89E-07 mr1088_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809549221 8.50E-06 8.50E-06 mr1108_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809549221 NA 7.07E-06 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809549221 NA 7.87E-06 mr1155_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809549221 NA 5.43E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809549221 6.29E-06 3.12E-08 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809549221 NA 7.87E-06 mr1437_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809549221 NA 4.43E-07 mr1458_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809549221 9.70E-06 9.70E-06 mr1541_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809549221 NA 1.88E-06 mr1620_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809549221 NA 2.58E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251