| Variant ID: vg0809548841 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 9548841 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCAGCTAAAATAAGACATATGTGTACAAGATAAATGTACCGGACTTACTTAAAATTATAAGCGGCCATGATGACTCTTATTTTGAAAGTGCAAGAAGGCT[C/T]
GTCCAATGTACTGTGCGACAGTAATCAATTTCTCCTTGTGCAAGCCCTTCTTGTATTCTGTTATCTCTTTTGCATTCTTGCCCTTCAGCTGGTTAGACCC
GGGTCTAACCAGCTGAAGGGCAAGAATGCAAAAGAGATAACAGAATACAAGAAGGGCTTGCACAAGGAGAAATTGATTACTGTCGCACAGTACATTGGAC[G/A]
AGCCTTCTTGCACTTTCAAAATAAGAGTCATCATGGCCGCTTATAATTTTAAGTAAGTCCGGTACATTTATCTTGTACACATATGTCTTATTTTAGCTGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.10% | 0.20% | 5.63% | 40.14% | NA |
| All Indica | 2759 | 57.80% | 0.00% | 6.71% | 35.52% | NA |
| All Japonica | 1512 | 45.30% | 0.50% | 4.30% | 49.87% | NA |
| Aus | 269 | 68.40% | 0.00% | 1.12% | 30.48% | NA |
| Indica I | 595 | 51.30% | 0.00% | 4.37% | 44.37% | NA |
| Indica II | 465 | 55.10% | 0.00% | 6.67% | 38.28% | NA |
| Indica III | 913 | 65.40% | 0.00% | 8.65% | 25.96% | NA |
| Indica Intermediate | 786 | 55.50% | 0.00% | 6.23% | 38.30% | NA |
| Temperate Japonica | 767 | 74.80% | 0.90% | 3.39% | 20.86% | NA |
| Tropical Japonica | 504 | 7.10% | 0.20% | 6.75% | 85.91% | NA |
| Japonica Intermediate | 241 | 31.10% | 0.00% | 2.07% | 66.80% | NA |
| VI/Aromatic | 96 | 44.80% | 0.00% | 8.33% | 46.88% | NA |
| Intermediate | 90 | 54.40% | 0.00% | 5.56% | 40.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0809548841 | C -> T | LOC_Os08g15720.1 | upstream_gene_variant ; 3121.0bp to feature; MODIFIER | silent_mutation | Average:6.67; most accessible tissue: Callus, score: 16.638 | N | N | N | N |
| vg0809548841 | C -> T | LOC_Os08g15730.1 | downstream_gene_variant ; 1231.0bp to feature; MODIFIER | silent_mutation | Average:6.67; most accessible tissue: Callus, score: 16.638 | N | N | N | N |
| vg0809548841 | C -> T | LOC_Os08g15750.1 | downstream_gene_variant ; 2279.0bp to feature; MODIFIER | silent_mutation | Average:6.67; most accessible tissue: Callus, score: 16.638 | N | N | N | N |
| vg0809548841 | C -> T | LOC_Os08g15760.1 | downstream_gene_variant ; 4580.0bp to feature; MODIFIER | silent_mutation | Average:6.67; most accessible tissue: Callus, score: 16.638 | N | N | N | N |
| vg0809548841 | C -> T | LOC_Os08g15740.1 | intron_variant ; MODIFIER | silent_mutation | Average:6.67; most accessible tissue: Callus, score: 16.638 | N | N | N | N |
| vg0809548841 | C -> DEL | N | N | silent_mutation | Average:6.67; most accessible tissue: Callus, score: 16.638 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0809548841 | NA | 1.84E-06 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809548841 | 8.79E-07 | 8.79E-07 | mr1525 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809548841 | NA | 5.55E-07 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |