Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0809540074:

Variant ID: vg0809540074 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 9540074
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.03, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

GTAAATACACTAAAATTACATATGTAATTTTCAGACTTACATTGTAAAATACATTAAAATTACATATGTAATTATAGTGTAAGTACGATGTAATTAGTAC[A/G]
CGTAGGATCGTAAACAACACGGCTCAAATCGATAATGATGGAGTCGGCAAGAATGCAACATGAATCTAAATAGATAAATCTGCAAGATATGGGACTCACA

Reverse complement sequence

TGTGAGTCCCATATCTTGCAGATTTATCTATTTAGATTCATGTTGCATTCTTGCCGACTCCATCATTATCGATTTGAGCCGTGTTGTTTACGATCCTACG[T/C]
GTACTAATTACATCGTACTTACACTATAATTACATATGTAATTTTAATGTATTTTACAATGTAAGTCTGAAAATTACATATGTAATTTTAGTGTATTTAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.90%	30.90%	12.63%	17.58%	NA
All Indica	2759	41.30%	23.40%	16.75%	18.56%	NA
All Japonica	1512	30.20%	46.20%	5.69%	17.92%	NA
Aus	269	46.10%	32.00%	10.04%	11.90%	NA
Indica I	595	30.10%	37.50%	20.50%	11.93%	NA
Indica II	465	55.70%	21.30%	10.97%	12.04%	NA
Indica III	913	35.80%	18.00%	18.62%	27.60%	NA
Indica Intermediate	786	47.70%	20.20%	15.14%	16.92%	NA
Temperate Japonica	767	4.30%	76.00%	1.56%	18.12%	NA
Tropical Japonica	504	62.90%	8.30%	10.32%	18.45%	NA
Japonica Intermediate	241	44.00%	30.70%	9.13%	16.18%	NA
VI/Aromatic	96	80.20%	1.00%	12.50%	6.25%	NA
Intermediate	90	46.70%	31.10%	11.11%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0809540074	A -> G	LOC_Os08g15710.1	downstream_gene_variant ; 318.0bp to feature; MODIFIER	silent_mutation	Average:31.528; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0809540074	A -> G	LOC_Os08g15720.1	downstream_gene_variant ; 3832.0bp to feature; MODIFIER	silent_mutation	Average:31.528; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0809540074	A -> G	LOC_Os08g15710-LOC_Os08g15720	intergenic_region ; MODIFIER	silent_mutation	Average:31.528; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0809540074	A -> DEL	N	N	silent_mutation	Average:31.528; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0809540074	NA	9.41E-12	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0809540074	NA	2.08E-06	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809540074	NA	9.45E-06	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809540074	NA	2.03E-06	mr1124	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809540074	NA	2.68E-06	mr1404	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809540074	NA	5.09E-06	mr1613	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809540074	1.55E-06	9.69E-09	mr1689	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809540074	NA	2.91E-07	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809540074	NA	8.37E-07	mr1962	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809540074	NA	6.86E-09	mr1879_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251