Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0809520451:

Variant ID: vg0809520451 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 9520451
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGATCTGGCAAGCGAGCCTCATGAGATACCGACTTAACGAGTCAATTCTACGTGACACGGGATCACCCAAATGATCAACCGAAACCGGCGAACGGAACCG[G/A]
CGGCTCTGAACGGCTCTAAACTAAAGGACGACTCCACACGGACGAACAAACGAAGCACCGGGGACACCTCGTTGAAACGAACGAGCGAACGACTCAACAA

Reverse complement sequence

TTGTTGAGTCGTTCGCTCGTTCGTTTCAACGAGGTGTCCCCGGTGCTTCGTTTGTTCGTCCGTGTGGAGTCGTCCTTTAGTTTAGAGCCGTTCAGAGCCG[C/T]
CGGTTCCGTTCGCCGGTTTCGGTTGATCATTTGGGTGATCCCGTGTCACGTAGAATTGACTCGTTAAGTCGGTATCTCATGAGGCTCGCTTGCCAGATCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.50%	7.10%	0.28%	8.19%	NA
All Indica	2759	95.40%	0.30%	0.14%	4.17%	NA
All Japonica	1512	72.40%	14.90%	0.46%	12.30%	NA
Aus	269	68.80%	0.00%	0.74%	30.48%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	81.50%	0.40%	0.43%	17.63%	NA
Indica III	913	99.50%	0.20%	0.00%	0.33%	NA
Indica Intermediate	786	95.40%	0.50%	0.25%	3.82%	NA
Temperate Japonica	767	71.30%	7.60%	0.78%	20.34%	NA
Tropical Japonica	504	68.30%	28.00%	0.00%	3.77%	NA
Japonica Intermediate	241	84.20%	10.80%	0.41%	4.56%	NA
VI/Aromatic	96	9.40%	90.60%	0.00%	0.00%	NA
Intermediate	90	80.00%	15.60%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0809520451	G -> A	LOC_Os08g15670.1	upstream_gene_variant ; 2297.0bp to feature; MODIFIER	silent_mutation	Average:37.568; most accessible tissue: Zhenshan97 flag leaf, score: 82.17	N	N	N	N
vg0809520451	G -> A	LOC_Os08g15680.1	downstream_gene_variant ; 2050.0bp to feature; MODIFIER	silent_mutation	Average:37.568; most accessible tissue: Zhenshan97 flag leaf, score: 82.17	N	N	N	N
vg0809520451	G -> A	LOC_Os08g15670-LOC_Os08g15680	intergenic_region ; MODIFIER	silent_mutation	Average:37.568; most accessible tissue: Zhenshan97 flag leaf, score: 82.17	N	N	N	N
vg0809520451	G -> DEL	N	N	silent_mutation	Average:37.568; most accessible tissue: Zhenshan97 flag leaf, score: 82.17	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0809520451	NA	4.30E-06	mr1940	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809520451	4.84E-06	NA	mr1089_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809520451	NA	4.64E-07	mr1129_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809520451	NA	6.16E-06	mr1148_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809520451	NA	8.52E-06	mr1204_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809520451	NA	7.77E-06	mr1596_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251