\
| Variant ID: vg0809520451 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 9520451 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGATCTGGCAAGCGAGCCTCATGAGATACCGACTTAACGAGTCAATTCTACGTGACACGGGATCACCCAAATGATCAACCGAAACCGGCGAACGGAACCG[G/A]
CGGCTCTGAACGGCTCTAAACTAAAGGACGACTCCACACGGACGAACAAACGAAGCACCGGGGACACCTCGTTGAAACGAACGAGCGAACGACTCAACAA
TTGTTGAGTCGTTCGCTCGTTCGTTTCAACGAGGTGTCCCCGGTGCTTCGTTTGTTCGTCCGTGTGGAGTCGTCCTTTAGTTTAGAGCCGTTCAGAGCCG[C/T]
CGGTTCCGTTCGCCGGTTTCGGTTGATCATTTGGGTGATCCCGTGTCACGTAGAATTGACTCGTTAAGTCGGTATCTCATGAGGCTCGCTTGCCAGATCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.50% | 7.10% | 0.28% | 8.19% | NA |
| All Indica | 2759 | 95.40% | 0.30% | 0.14% | 4.17% | NA |
| All Japonica | 1512 | 72.40% | 14.90% | 0.46% | 12.30% | NA |
| Aus | 269 | 68.80% | 0.00% | 0.74% | 30.48% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 81.50% | 0.40% | 0.43% | 17.63% | NA |
| Indica III | 913 | 99.50% | 0.20% | 0.00% | 0.33% | NA |
| Indica Intermediate | 786 | 95.40% | 0.50% | 0.25% | 3.82% | NA |
| Temperate Japonica | 767 | 71.30% | 7.60% | 0.78% | 20.34% | NA |
| Tropical Japonica | 504 | 68.30% | 28.00% | 0.00% | 3.77% | NA |
| Japonica Intermediate | 241 | 84.20% | 10.80% | 0.41% | 4.56% | NA |
| VI/Aromatic | 96 | 9.40% | 90.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 15.60% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0809520451 | G -> A | LOC_Os08g15670.1 | upstream_gene_variant ; 2297.0bp to feature; MODIFIER | silent_mutation | Average:37.568; most accessible tissue: Zhenshan97 flag leaf, score: 82.17 | N | N | N | N |
| vg0809520451 | G -> A | LOC_Os08g15680.1 | downstream_gene_variant ; 2050.0bp to feature; MODIFIER | silent_mutation | Average:37.568; most accessible tissue: Zhenshan97 flag leaf, score: 82.17 | N | N | N | N |
| vg0809520451 | G -> A | LOC_Os08g15670-LOC_Os08g15680 | intergenic_region ; MODIFIER | silent_mutation | Average:37.568; most accessible tissue: Zhenshan97 flag leaf, score: 82.17 | N | N | N | N |
| vg0809520451 | G -> DEL | N | N | silent_mutation | Average:37.568; most accessible tissue: Zhenshan97 flag leaf, score: 82.17 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0809520451 | NA | 4.30E-06 | mr1940 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809520451 | 4.84E-06 | NA | mr1089_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809520451 | NA | 4.64E-07 | mr1129_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809520451 | NA | 6.16E-06 | mr1148_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809520451 | NA | 8.52E-06 | mr1204_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809520451 | NA | 7.77E-06 | mr1596_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |