\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0809520451:

Variant ID: vg0809520451 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 9520451
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGATCTGGCAAGCGAGCCTCATGAGATACCGACTTAACGAGTCAATTCTACGTGACACGGGATCACCCAAATGATCAACCGAAACCGGCGAACGGAACCG[G/A]
CGGCTCTGAACGGCTCTAAACTAAAGGACGACTCCACACGGACGAACAAACGAAGCACCGGGGACACCTCGTTGAAACGAACGAGCGAACGACTCAACAA

Reverse complement sequence

TTGTTGAGTCGTTCGCTCGTTCGTTTCAACGAGGTGTCCCCGGTGCTTCGTTTGTTCGTCCGTGTGGAGTCGTCCTTTAGTTTAGAGCCGTTCAGAGCCG[C/T]
CGGTTCCGTTCGCCGGTTTCGGTTGATCATTTGGGTGATCCCGTGTCACGTAGAATTGACTCGTTAAGTCGGTATCTCATGAGGCTCGCTTGCCAGATCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.50% 7.10% 0.28% 8.19% NA
All Indica  2759 95.40% 0.30% 0.14% 4.17% NA
All Japonica  1512 72.40% 14.90% 0.46% 12.30% NA
Aus  269 68.80% 0.00% 0.74% 30.48% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 81.50% 0.40% 0.43% 17.63% NA
Indica III  913 99.50% 0.20% 0.00% 0.33% NA
Indica Intermediate  786 95.40% 0.50% 0.25% 3.82% NA
Temperate Japonica  767 71.30% 7.60% 0.78% 20.34% NA
Tropical Japonica  504 68.30% 28.00% 0.00% 3.77% NA
Japonica Intermediate  241 84.20% 10.80% 0.41% 4.56% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 80.00% 15.60% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0809520451 G -> A LOC_Os08g15670.1 upstream_gene_variant ; 2297.0bp to feature; MODIFIER silent_mutation Average:37.568; most accessible tissue: Zhenshan97 flag leaf, score: 82.17 N N N N
vg0809520451 G -> A LOC_Os08g15680.1 downstream_gene_variant ; 2050.0bp to feature; MODIFIER silent_mutation Average:37.568; most accessible tissue: Zhenshan97 flag leaf, score: 82.17 N N N N
vg0809520451 G -> A LOC_Os08g15670-LOC_Os08g15680 intergenic_region ; MODIFIER silent_mutation Average:37.568; most accessible tissue: Zhenshan97 flag leaf, score: 82.17 N N N N
vg0809520451 G -> DEL N N silent_mutation Average:37.568; most accessible tissue: Zhenshan97 flag leaf, score: 82.17 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0809520451 NA 4.30E-06 mr1940 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809520451 4.84E-06 NA mr1089_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809520451 NA 4.64E-07 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809520451 NA 6.16E-06 mr1148_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809520451 NA 8.52E-06 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809520451 NA 7.77E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251