\
| Variant ID: vg0809461403 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 9461403 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTATCCACACATCTCTCTCCCTTCTTTTTATCTCAGCAACCAATCAACCATAGCTCTCCCTCCCCAGCTGAGCACCCCCTGAGTGGCCCCCATGTCCTCT[C/T]
GGGCCCCGAGCGCCAGAGGCCGCTTCCTCCACCCCAAGCGACGACCGTCGCCGTCGCCGTCGTCACATCGACCTCGAGTGTCAGCGAGCTCGCTTCTCCG
CGGAGAAGCGAGCTCGCTGACACTCGAGGTCGATGTGACGACGGCGACGGCGACGGTCGTCGCTTGGGGTGGAGGAAGCGGCCTCTGGCGCTCGGGGCCC[G/A]
AGAGGACATGGGGGCCACTCAGGGGGTGCTCAGCTGGGGAGGGAGAGCTATGGTTGATTGGTTGCTGAGATAAAAAGAAGGGAGAGAGATGTGTGGATAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.10% | 10.60% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 86.00% | 13.80% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.10% | 0.40% | 0.00% | NA |
| Aus | 269 | 59.10% | 40.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 85.20% | 14.30% | 0.50% | 0.00% | NA |
| Indica II | 465 | 95.10% | 4.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 79.70% | 20.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.70% | 11.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.10% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.40% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 5.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0809461403 | C -> T | LOC_Os08g15550.1 | upstream_gene_variant ; 1921.0bp to feature; MODIFIER | silent_mutation | Average:62.307; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| vg0809461403 | C -> T | LOC_Os08g15570.1 | upstream_gene_variant ; 2600.0bp to feature; MODIFIER | silent_mutation | Average:62.307; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| vg0809461403 | C -> T | LOC_Os08g15560.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.307; most accessible tissue: Zhenshan97 young leaf, score: 76.44 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0809461403 | NA | 4.36E-06 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809461403 | NA | 8.21E-07 | mr1202 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809461403 | NA | 3.60E-07 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809461403 | 3.45E-06 | 5.51E-06 | mr1600 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |