Variant ID: vg0809374950 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 9374950 |
Reference Allele: C | Alternative Allele: A |
Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.56, C: 0.44, others allele: 0.00, population size: 90. )
TAATCCCATATCAACTGGATTAGGGCTATTACCTACCAAGGGGCCTGAACCAGTATAATCCCTGTTTCCTGTTTGCTTGATGTCGTACTATGTAGATCCT[C/A]
GTACCAGCGTACCCCAATACCCTCTATATCTGGTCTACGGGTATCCCCCATCGACAAATACCACCAGAAGCACCCCTTGAGGGAGAATAAGCAAACTTGT
ACAAGTTTGCTTATTCTCCCTCAAGGGGTGCTTCTGGTGGTATTTGTCGATGGGGGATACCCGTAGACCAGATATAGAGGGTATTGGGGTACGCTGGTAC[G/T]
AGGATCTACATAGTACGACATCAAGCAAACAGGAAACAGGGATTATACTGGTTCAGGCCCCTTGGTAGGTAATAGCCCTAATCCAGTTGATATGGGATTA
Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 44.10% | 42.90% | 2.98% | 10.07% | NA |
All Indica | 2759 | 31.40% | 63.90% | 3.91% | 0.76% | NA |
All Japonica | 1512 | 66.90% | 6.80% | 0.99% | 25.26% | NA |
Aus | 269 | 56.10% | 43.90% | 0.00% | 0.00% | NA |
Indica I | 595 | 42.70% | 57.30% | 0.00% | 0.00% | NA |
Indica II | 465 | 68.80% | 18.30% | 10.75% | 2.15% | NA |
Indica III | 913 | 2.40% | 93.40% | 3.72% | 0.44% | NA |
Indica Intermediate | 786 | 34.40% | 61.70% | 3.05% | 0.89% | NA |
Temperate Japonica | 767 | 96.60% | 1.80% | 0.00% | 1.56% | NA |
Tropical Japonica | 504 | 22.20% | 13.90% | 2.58% | 61.31% | NA |
Japonica Intermediate | 241 | 66.00% | 7.90% | 0.83% | 25.31% | NA |
VI/Aromatic | 96 | 4.20% | 11.50% | 14.58% | 69.79% | NA |
Intermediate | 90 | 55.60% | 33.30% | 4.44% | 6.67% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0809374950 | C -> A | LOC_Os08g15390.1 | upstream_gene_variant ; 4839.0bp to feature; MODIFIER | silent_mutation | Average:44.046; most accessible tissue: Minghui63 flag leaf, score: 55.781 | N | N | N | N |
vg0809374950 | C -> A | LOC_Os08g15400.1 | upstream_gene_variant ; 893.0bp to feature; MODIFIER | silent_mutation | Average:44.046; most accessible tissue: Minghui63 flag leaf, score: 55.781 | N | N | N | N |
vg0809374950 | C -> A | LOC_Os08g15410.1 | downstream_gene_variant ; 294.0bp to feature; MODIFIER | silent_mutation | Average:44.046; most accessible tissue: Minghui63 flag leaf, score: 55.781 | N | N | N | N |
vg0809374950 | C -> A | LOC_Os08g15400-LOC_Os08g15410 | intergenic_region ; MODIFIER | silent_mutation | Average:44.046; most accessible tissue: Minghui63 flag leaf, score: 55.781 | N | N | N | N |
vg0809374950 | C -> DEL | N | N | silent_mutation | Average:44.046; most accessible tissue: Minghui63 flag leaf, score: 55.781 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0809374950 | NA | 1.11E-06 | mr1042 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0809374950 | NA | 1.71E-07 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0809374950 | NA | 9.81E-07 | mr1043 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0809374950 | NA | 1.02E-06 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0809374950 | NA | 9.18E-08 | mr1059 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0809374950 | NA | 9.25E-19 | mr1133 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0809374950 | NA | 8.51E-10 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0809374950 | NA | 3.57E-08 | mr1535 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0809374950 | NA | 4.30E-06 | mr1870 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0809374950 | NA | 1.68E-07 | mr1919 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0809374950 | NA | 3.66E-10 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0809374950 | NA | 9.67E-06 | mr1360_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0809374950 | NA | 3.40E-08 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0809374950 | NA | 3.60E-06 | mr1994_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |