\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0809374950:

Variant ID: vg0809374950 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 9374950
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.56, C: 0.44, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TAATCCCATATCAACTGGATTAGGGCTATTACCTACCAAGGGGCCTGAACCAGTATAATCCCTGTTTCCTGTTTGCTTGATGTCGTACTATGTAGATCCT[C/A]
GTACCAGCGTACCCCAATACCCTCTATATCTGGTCTACGGGTATCCCCCATCGACAAATACCACCAGAAGCACCCCTTGAGGGAGAATAAGCAAACTTGT

Reverse complement sequence

ACAAGTTTGCTTATTCTCCCTCAAGGGGTGCTTCTGGTGGTATTTGTCGATGGGGGATACCCGTAGACCAGATATAGAGGGTATTGGGGTACGCTGGTAC[G/T]
AGGATCTACATAGTACGACATCAAGCAAACAGGAAACAGGGATTATACTGGTTCAGGCCCCTTGGTAGGTAATAGCCCTAATCCAGTTGATATGGGATTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.10% 42.90% 2.98% 10.07% NA
All Indica  2759 31.40% 63.90% 3.91% 0.76% NA
All Japonica  1512 66.90% 6.80% 0.99% 25.26% NA
Aus  269 56.10% 43.90% 0.00% 0.00% NA
Indica I  595 42.70% 57.30% 0.00% 0.00% NA
Indica II  465 68.80% 18.30% 10.75% 2.15% NA
Indica III  913 2.40% 93.40% 3.72% 0.44% NA
Indica Intermediate  786 34.40% 61.70% 3.05% 0.89% NA
Temperate Japonica  767 96.60% 1.80% 0.00% 1.56% NA
Tropical Japonica  504 22.20% 13.90% 2.58% 61.31% NA
Japonica Intermediate  241 66.00% 7.90% 0.83% 25.31% NA
VI/Aromatic  96 4.20% 11.50% 14.58% 69.79% NA
Intermediate  90 55.60% 33.30% 4.44% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0809374950 C -> A LOC_Os08g15390.1 upstream_gene_variant ; 4839.0bp to feature; MODIFIER silent_mutation Average:44.046; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0809374950 C -> A LOC_Os08g15400.1 upstream_gene_variant ; 893.0bp to feature; MODIFIER silent_mutation Average:44.046; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0809374950 C -> A LOC_Os08g15410.1 downstream_gene_variant ; 294.0bp to feature; MODIFIER silent_mutation Average:44.046; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0809374950 C -> A LOC_Os08g15400-LOC_Os08g15410 intergenic_region ; MODIFIER silent_mutation Average:44.046; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0809374950 C -> DEL N N silent_mutation Average:44.046; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0809374950 NA 1.11E-06 mr1042 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809374950 NA 1.71E-07 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809374950 NA 9.81E-07 mr1043 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809374950 NA 1.02E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809374950 NA 9.18E-08 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809374950 NA 9.25E-19 mr1133 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809374950 NA 8.51E-10 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809374950 NA 3.57E-08 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809374950 NA 4.30E-06 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809374950 NA 1.68E-07 mr1919 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809374950 NA 3.66E-10 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809374950 NA 9.67E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809374950 NA 3.40E-08 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809374950 NA 3.60E-06 mr1994_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251