Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0809365446:

Variant ID: vg0809365446 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 9365446
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACGACTGGCGCACCCCACTCATTAAATTCAAGCAGCCACGAAGAGTTGCCCGAGGACGACGCAGAAGCCGAGAAAATATCCCGTAAAGCAAAAGTCTACT[G/A]
TATGATCGGCAACGATCTATACAAGAAGGCACTAAACGGGGTACTCCTAAAATGCGTCTCGTCCAACGACGGCAGACACCTCCTGCTCGACATACATGAA

Reverse complement sequence

TTCATGTATGTCGAGCAGGAGGTGTCTGCCGTCGTTGGACGAGACGCATTTTAGGAGTACCCCGTTTAGTGCCTTCTTGTATAGATCGTTGCCGATCATA[C/T]
AGTAGACTTTTGCTTTACGGGATATTTTCTCGGCTTCTGCGTCGTCCTCGGGCAACTCTTCGTGGCTGCTTGAATTTAATGAGTGGGGTGCGCCAGTCGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.70%	5.60%	3.72%	23.99%	NA
All Indica	2759	62.70%	1.60%	3.70%	31.97%	NA
All Japonica	1512	70.40%	12.60%	3.11%	13.89%	NA
Aus	269	88.10%	1.90%	0.74%	9.29%	NA
Indica I	595	58.00%	0.00%	0.84%	41.18%	NA
Indica II	465	83.40%	1.30%	2.15%	13.12%	NA
Indica III	913	54.10%	3.00%	6.13%	36.80%	NA
Indica Intermediate	786	64.10%	1.40%	3.94%	30.53%	NA
Temperate Japonica	767	97.40%	0.70%	0.52%	1.43%	NA
Tropical Japonica	504	27.80%	32.50%	7.14%	32.54%	NA
Japonica Intermediate	241	73.40%	9.10%	2.90%	14.52%	NA
VI/Aromatic	96	53.10%	21.90%	21.88%	3.12%	NA
Intermediate	90	74.40%	5.60%	4.44%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0809365446	G -> A	LOC_Os08g15380.1	upstream_gene_variant ; 764.0bp to feature; MODIFIER	silent_mutation	Average:35.792; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0809365446	G -> A	LOC_Os08g15370.1	downstream_gene_variant ; 401.0bp to feature; MODIFIER	silent_mutation	Average:35.792; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0809365446	G -> A	LOC_Os08g15390.1	downstream_gene_variant ; 3871.0bp to feature; MODIFIER	silent_mutation	Average:35.792; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0809365446	G -> A	LOC_Os08g15370-LOC_Os08g15380	intergenic_region ; MODIFIER	silent_mutation	Average:35.792; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0809365446	G -> DEL	N	N	silent_mutation	Average:35.792; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0809365446	1.94E-06	NA	mr1016	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809365446	3.73E-06	2.35E-08	mr1019	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809365446	1.40E-06	NA	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809365446	9.37E-06	NA	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809365446	NA	2.74E-06	mr1342	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809365446	6.35E-06	NA	mr1390	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251