\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0809349508:

Variant ID: vg0809349508 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 9349508
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCAGCATGCAATTGACCCGCCCCCCCCTCCTCGGAAATCGCAACAACATTTTTTATCAACATTGGAATTTCTATTTTTCTTGTCCGTTTTCACTTTTTTC[T/C]
ATCTTTCTTGTCCTATTGGAATTTTTTTTGTCCGTTTCCAACTTTTTTTTTGTCTGTTTACTCTTTGTTTGTTTTGTCCGTTTACACAAAACCTAATCGT

Reverse complement sequence

ACGATTAGGTTTTGTGTAAACGGACAAAACAAACAAAGAGTAAACAGACAAAAAAAAAGTTGGAAACGGACAAAAAAAATTCCAATAGGACAAGAAAGAT[A/G]
GAAAAAAGTGAAAACGGACAAGAAAAATAGAAATTCCAATGTTGATAAAAAATGTTGTTGCGATTTCCGAGGAGGGGGGGGCGGGTCAATTGCATGCTGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.50% 8.30% 0.15% 12.97% NA
All Indica  2759 85.30% 9.80% 0.00% 4.86% NA
All Japonica  1512 73.60% 0.10% 0.40% 25.86% NA
Aus  269 58.40% 41.60% 0.00% 0.00% NA
Indica I  595 92.30% 7.70% 0.00% 0.00% NA
Indica II  465 85.40% 1.50% 0.00% 13.12% NA
Indica III  913 76.80% 18.60% 0.00% 4.60% NA
Indica Intermediate  786 89.90% 6.10% 0.00% 3.94% NA
Temperate Japonica  767 98.40% 0.00% 0.13% 1.43% NA
Tropical Japonica  504 36.10% 0.00% 0.99% 62.90% NA
Japonica Intermediate  241 73.00% 0.80% 0.00% 26.14% NA
VI/Aromatic  96 13.50% 4.20% 1.04% 81.25% NA
Intermediate  90 83.30% 5.60% 0.00% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0809349508 T -> C LOC_Os08g15340-LOC_Os08g15350 intergenic_region ; MODIFIER silent_mutation Average:64.361; most accessible tissue: Zhenshan97 panicle, score: 90.661 N N N N
vg0809349508 T -> DEL N N silent_mutation Average:64.361; most accessible tissue: Zhenshan97 panicle, score: 90.661 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0809349508 NA 7.26E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809349508 NA 1.52E-06 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809349508 NA 4.09E-06 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809349508 NA 5.64E-11 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809349508 NA 1.38E-11 mr1180 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809349508 NA 8.52E-10 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809349508 NA 5.38E-06 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809349508 NA 4.65E-08 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809349508 NA 5.02E-10 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809349508 NA 8.70E-08 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809349508 8.38E-06 5.05E-06 mr1600 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809349508 8.75E-07 3.14E-06 mr1622 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809349508 NA 4.34E-08 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809349508 NA 1.18E-06 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809349508 NA 9.86E-09 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809349508 NA 1.00E-08 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251