Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0809343839:

Variant ID: vg0809343839 (JBrowse)	Variation Type: INDEL
Chromosome: chr08	Position: 9343839
Reference Allele: CT	Alternative Allele: GT,C
Primary Allele: CT	Secondary Allele: GT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGTTTAGGTGAGCCACCAGTGAAAAGGGATACATTTTCATTGGCGGCGCTCTTAACCACGTTGTTAGCAGAGATCCATTTTCGCTGGCGGCCCATAACCC[CT/GT,C]
CATCCCTCGTTACATTGTTGCCGATGGTTTTGATGTATGGCCGTCAGAGAAAATGATAGGGTGACGCCATGAAAAATCGATTTGGTAGTAGTGAATTAGA

Reverse complement sequence

TCTAATTCACTACTACCAAATCGATTTTTCATGGCGTCACCCTATCATTTTCTCTGACGGCCATACATCAAAACCATCGGCAACAATGTAACGAGGGATG[AG/AC,G]
GGGTTATGGGCCGCCAGCGAAAATGGATCTCTGCTAACAACGTGGTTAAGAGCGCCGCCAATGAAAATGTATCCCTTTTCACTGGTGGCTCACCTAAACG

Allele Frequencies:

Populations	Population Size	Frequency of CT(primary allele)	Frequency of GT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.30%	32.10%	0.47%	2.31%	C: 4.76%
All Indica	2759	48.60%	46.40%	0.54%	3.95%	C: 0.43%
All Japonica	1512	85.40%	6.20%	0.20%	0.00%	C: 8.20%
Aus	269	57.20%	42.80%	0.00%	0.00%	NA
Indica I	595	47.20%	52.80%	0.00%	0.00%	NA
Indica II	465	75.50%	10.80%	1.08%	12.26%	C: 0.43%
Indica III	913	32.60%	63.00%	0.33%	3.61%	C: 0.44%
Indica Intermediate	786	52.40%	43.50%	0.89%	2.42%	C: 0.76%
Temperate Japonica	767	98.20%	1.60%	0.00%	0.00%	C: 0.26%
Tropical Japonica	504	66.90%	12.70%	0.40%	0.00%	C: 20.04%
Japonica Intermediate	241	83.40%	7.50%	0.41%	0.00%	C: 8.71%
VI/Aromatic	96	4.20%	8.30%	3.12%	0.00%	C: 84.38%
Intermediate	90	66.70%	23.30%	1.11%	0.00%	C: 8.89%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0809343839	CT -> GT	LOC_Os08g15340.1	upstream_gene_variant ; 300.0bp to feature; MODIFIER	silent_mutation	Average:42.817; most accessible tissue: Zhenshan97 young leaf, score: 64.747	N	N	N	N
vg0809343839	CT -> GT	LOC_Os08g15340-LOC_Os08g15350	intergenic_region ; MODIFIER	silent_mutation	Average:42.817; most accessible tissue: Zhenshan97 young leaf, score: 64.747	N	N	N	N
vg0809343839	CT -> C	LOC_Os08g15340.1	upstream_gene_variant ; 301.0bp to feature; MODIFIER	silent_mutation	Average:42.817; most accessible tissue: Zhenshan97 young leaf, score: 64.747	N	N	N	N
vg0809343839	CT -> C	LOC_Os08g15340-LOC_Os08g15350	intergenic_region ; MODIFIER	silent_mutation	Average:42.817; most accessible tissue: Zhenshan97 young leaf, score: 64.747	N	N	N	N
vg0809343839	CT -> DEL	N	N	silent_mutation	Average:42.817; most accessible tissue: Zhenshan97 young leaf, score: 64.747	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0809343839	NA	6.89E-16	Plant_height	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0809343839	NA	8.18E-09	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809343839	NA	3.63E-08	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809343839	NA	6.38E-10	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809343839	NA	9.82E-11	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809343839	NA	1.03E-09	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809343839	NA	7.48E-06	mr1870	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809343839	NA	1.79E-12	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809343839	NA	1.90E-06	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809343839	NA	2.60E-10	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809343839	NA	8.63E-13	mr1183_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809343839	NA	2.54E-06	mr1260_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809343839	NA	1.19E-09	mr1327_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809343839	NA	3.22E-07	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809343839	NA	4.22E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251