\
| Variant ID: vg0809212456 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 9212456 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.86, G: 0.14, others allele: 0.00, population size: 58. )
TAAATATAAATCGGGGTGGATTTTTATCATCCGCATGTGAAAATCAATTTTTCCAGGCGGACCACTTAAGGGGTTCGCCTGCGAAAATATATTTATTTTC[A/G]
CAGGTGGACCCCTTAAGTGGTCCGTTTGAAAAAATATGATTTTTCTGGGCGGAACCTTATATATAGTCCGCCTGCAAAAATGTCAAAAAAAAAAATCTTC
GAAGATTTTTTTTTTTGACATTTTTGCAGGCGGACTATATATAAGGTTCCGCCCAGAAAAATCATATTTTTTCAAACGGACCACTTAAGGGGTCCACCTG[T/C]
GAAAATAAATATATTTTCGCAGGCGAACCCCTTAAGTGGTCCGCCTGGAAAAATTGATTTTCACATGCGGATGATAAAAATCCACCCCGATTTATATTTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.90% | 39.70% | 0.51% | 0.91% | NA |
| All Indica | 2759 | 71.40% | 27.60% | 0.29% | 0.72% | NA |
| All Japonica | 1512 | 42.30% | 55.40% | 0.86% | 1.52% | NA |
| Aus | 269 | 42.40% | 57.20% | 0.37% | 0.00% | NA |
| Indica I | 595 | 80.00% | 19.30% | 0.17% | 0.50% | NA |
| Indica II | 465 | 22.20% | 74.40% | 0.65% | 2.80% | NA |
| Indica III | 913 | 92.30% | 7.30% | 0.11% | 0.22% | NA |
| Indica Intermediate | 786 | 69.70% | 29.60% | 0.38% | 0.25% | NA |
| Temperate Japonica | 767 | 58.70% | 39.10% | 0.91% | 1.30% | NA |
| Tropical Japonica | 504 | 21.60% | 76.00% | 0.60% | 1.79% | NA |
| Japonica Intermediate | 241 | 33.20% | 63.90% | 1.24% | 1.66% | NA |
| VI/Aromatic | 96 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 44.40% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0809212456 | A -> G | LOC_Os08g15220.1 | upstream_gene_variant ; 890.0bp to feature; MODIFIER | silent_mutation | Average:65.193; most accessible tissue: Minghui63 young leaf, score: 76.385 | N | N | N | N |
| vg0809212456 | A -> G | LOC_Os08g15204-LOC_Os08g15220 | intergenic_region ; MODIFIER | silent_mutation | Average:65.193; most accessible tissue: Minghui63 young leaf, score: 76.385 | N | N | N | N |
| vg0809212456 | A -> DEL | N | N | silent_mutation | Average:65.193; most accessible tissue: Minghui63 young leaf, score: 76.385 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0809212456 | NA | 2.15E-06 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809212456 | NA | 9.47E-08 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809212456 | NA | 6.85E-08 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809212456 | NA | 7.60E-07 | mr1323_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809212456 | NA | 4.51E-08 | mr1330_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809212456 | NA | 3.10E-07 | mr1360_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809212456 | NA | 3.17E-06 | mr1448_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809212456 | NA | 3.05E-06 | mr1449_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809212456 | NA | 5.36E-07 | mr1540_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809212456 | NA | 2.29E-08 | mr1553_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809212456 | NA | 2.02E-09 | mr1715_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809212456 | NA | 1.67E-07 | mr1732_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809212456 | NA | 3.44E-06 | mr1994_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |