\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0809150804:

Variant ID: vg0809150804 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 9150804
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGGAGTCCGGCTGTTGCGAAAACTTTCTAGCCTCCAAACGCTCTTCGTCTTCTCCGCTTCCACGCAAACCCTAATTCGCTCGCCTCAGCTTCTTCTCC[A/G]
GCGATCTCCAACGGCAATGGACCTCGACAAGTCTACCTCCAACAGTGCATCCTTGAAGAAAATGCAGGAGGAGGGCACTCTCCCCGGTCGTGGGACCATG

Reverse complement sequence

CATGGTCCCACGACCGGGGAGAGTGCCCTCCTCCTGCATTTTCTTCAAGGATGCACTGTTGGAGGTAGACTTGTCGAGGTCCATTGCCGTTGGAGATCGC[T/C]
GGAGAAGAAGCTGAGGCGAGCGAATTAGGGTTTGCGTGGAAGCGGAGAAGACGAAGAGCGTTTGGAGGCTAGAAAGTTTTCGCAACAGCCGGACTCCAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.40% 16.30% 1.21% 55.04% NA
All Indica  2759 35.80% 1.70% 1.09% 61.36% NA
All Japonica  1512 1.20% 42.10% 1.32% 55.36% NA
Aus  269 96.30% 0.00% 0.00% 3.72% NA
Indica I  595 36.00% 3.20% 0.67% 60.17% NA
Indica II  465 37.20% 1.70% 1.72% 59.35% NA
Indica III  913 34.00% 0.40% 0.33% 65.28% NA
Indica Intermediate  786 37.20% 2.00% 1.91% 58.91% NA
Temperate Japonica  767 0.70% 71.20% 1.17% 26.99% NA
Tropical Japonica  504 1.40% 3.00% 1.59% 94.05% NA
Japonica Intermediate  241 2.50% 31.50% 1.24% 64.73% NA
VI/Aromatic  96 9.40% 69.80% 4.17% 16.67% NA
Intermediate  90 24.40% 22.20% 3.33% 50.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0809150804 A -> G LOC_Os08g15100.1 upstream_gene_variant ; 17.0bp to feature; MODIFIER silent_mutation Average:49.111; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg0809150804 A -> G LOC_Os08g15110.1 downstream_gene_variant ; 3989.0bp to feature; MODIFIER silent_mutation Average:49.111; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg0809150804 A -> G LOC_Os08g15090-LOC_Os08g15100 intergenic_region ; MODIFIER silent_mutation Average:49.111; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N
vg0809150804 A -> DEL N N silent_mutation Average:49.111; most accessible tissue: Minghui63 flag leaf, score: 76.807 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0809150804 NA 2.12E-07 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809150804 NA 7.73E-09 mr1227 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809150804 NA 4.20E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809150804 NA 2.33E-10 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809150804 NA 1.75E-14 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251