\
| Variant ID: vg0809150804 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 9150804 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTTGGAGTCCGGCTGTTGCGAAAACTTTCTAGCCTCCAAACGCTCTTCGTCTTCTCCGCTTCCACGCAAACCCTAATTCGCTCGCCTCAGCTTCTTCTCC[A/G]
GCGATCTCCAACGGCAATGGACCTCGACAAGTCTACCTCCAACAGTGCATCCTTGAAGAAAATGCAGGAGGAGGGCACTCTCCCCGGTCGTGGGACCATG
CATGGTCCCACGACCGGGGAGAGTGCCCTCCTCCTGCATTTTCTTCAAGGATGCACTGTTGGAGGTAGACTTGTCGAGGTCCATTGCCGTTGGAGATCGC[T/C]
GGAGAAGAAGCTGAGGCGAGCGAATTAGGGTTTGCGTGGAAGCGGAGAAGACGAAGAGCGTTTGGAGGCTAGAAAGTTTTCGCAACAGCCGGACTCCAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.40% | 16.30% | 1.21% | 55.04% | NA |
| All Indica | 2759 | 35.80% | 1.70% | 1.09% | 61.36% | NA |
| All Japonica | 1512 | 1.20% | 42.10% | 1.32% | 55.36% | NA |
| Aus | 269 | 96.30% | 0.00% | 0.00% | 3.72% | NA |
| Indica I | 595 | 36.00% | 3.20% | 0.67% | 60.17% | NA |
| Indica II | 465 | 37.20% | 1.70% | 1.72% | 59.35% | NA |
| Indica III | 913 | 34.00% | 0.40% | 0.33% | 65.28% | NA |
| Indica Intermediate | 786 | 37.20% | 2.00% | 1.91% | 58.91% | NA |
| Temperate Japonica | 767 | 0.70% | 71.20% | 1.17% | 26.99% | NA |
| Tropical Japonica | 504 | 1.40% | 3.00% | 1.59% | 94.05% | NA |
| Japonica Intermediate | 241 | 2.50% | 31.50% | 1.24% | 64.73% | NA |
| VI/Aromatic | 96 | 9.40% | 69.80% | 4.17% | 16.67% | NA |
| Intermediate | 90 | 24.40% | 22.20% | 3.33% | 50.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0809150804 | A -> G | LOC_Os08g15100.1 | upstream_gene_variant ; 17.0bp to feature; MODIFIER | silent_mutation | Average:49.111; most accessible tissue: Minghui63 flag leaf, score: 76.807 | N | N | N | N |
| vg0809150804 | A -> G | LOC_Os08g15110.1 | downstream_gene_variant ; 3989.0bp to feature; MODIFIER | silent_mutation | Average:49.111; most accessible tissue: Minghui63 flag leaf, score: 76.807 | N | N | N | N |
| vg0809150804 | A -> G | LOC_Os08g15090-LOC_Os08g15100 | intergenic_region ; MODIFIER | silent_mutation | Average:49.111; most accessible tissue: Minghui63 flag leaf, score: 76.807 | N | N | N | N |
| vg0809150804 | A -> DEL | N | N | silent_mutation | Average:49.111; most accessible tissue: Minghui63 flag leaf, score: 76.807 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0809150804 | NA | 2.12E-07 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809150804 | NA | 7.73E-09 | mr1227 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809150804 | NA | 4.20E-10 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809150804 | NA | 2.33E-10 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809150804 | NA | 1.75E-14 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |