| Variant ID: vg0809149905 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 9149905 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACAAAGACGACAATGATGCTATTGACATTTATGAAGATTTGGGCCATGCATACTGTCAACGGTGGGTACCCGTAGACCGGATATAGAGGGTATTGGGGTA[T/C]
GTTGGTACGAGGATCTACGTAGTACGACATCAAGAAAACAAAAGACAAAGATTATACTGGTTTAGGCCCCTTGATAGGTAATAGCCCTAATCCAGTTGTT
AACAACTGGATTAGGGCTATTACCTATCAAGGGGCCTAAACCAGTATAATCTTTGTCTTTTGTTTTCTTGATGTCGTACTACGTAGATCCTCGTACCAAC[A/G]
TACCCCAATACCCTCTATATCCGGTCTACGGGTACCCACCGTTGACAGTATGCATGGCCCAAATCTTCATAAATGTCAATAGCATCATTGTCGTCTTTGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.50% | 12.60% | 2.67% | 57.28% | NA |
| All Indica | 2759 | 35.90% | 1.60% | 1.20% | 61.33% | NA |
| All Japonica | 1512 | 1.50% | 35.00% | 2.58% | 60.98% | NA |
| Aus | 269 | 96.30% | 0.70% | 0.00% | 2.97% | NA |
| Indica I | 595 | 36.10% | 2.20% | 0.84% | 60.84% | NA |
| Indica II | 465 | 38.10% | 1.10% | 1.08% | 59.78% | NA |
| Indica III | 913 | 33.80% | 1.20% | 0.44% | 64.51% | NA |
| Indica Intermediate | 786 | 36.80% | 1.90% | 2.42% | 58.91% | NA |
| Temperate Japonica | 767 | 0.90% | 59.70% | 1.96% | 37.42% | NA |
| Tropical Japonica | 504 | 1.80% | 2.20% | 3.77% | 92.26% | NA |
| Japonica Intermediate | 241 | 2.50% | 24.90% | 2.07% | 70.54% | NA |
| VI/Aromatic | 96 | 9.40% | 1.00% | 51.04% | 38.54% | NA |
| Intermediate | 90 | 21.10% | 20.00% | 5.56% | 53.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0809149905 | T -> C | LOC_Os08g15100.1 | upstream_gene_variant ; 916.0bp to feature; MODIFIER | silent_mutation | Average:50.955; most accessible tissue: Minghui63 flag leaf, score: 69.182 | N | N | N | N |
| vg0809149905 | T -> C | LOC_Os08g15110.1 | downstream_gene_variant ; 4888.0bp to feature; MODIFIER | silent_mutation | Average:50.955; most accessible tissue: Minghui63 flag leaf, score: 69.182 | N | N | N | N |
| vg0809149905 | T -> C | LOC_Os08g15090-LOC_Os08g15100 | intergenic_region ; MODIFIER | silent_mutation | Average:50.955; most accessible tissue: Minghui63 flag leaf, score: 69.182 | N | N | N | N |
| vg0809149905 | T -> DEL | N | N | silent_mutation | Average:50.955; most accessible tissue: Minghui63 flag leaf, score: 69.182 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0809149905 | NA | 6.00E-08 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809149905 | NA | 8.33E-08 | mr1227 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809149905 | NA | 5.38E-06 | mr1342 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809149905 | 1.57E-06 | 9.72E-12 | mr1659 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |