\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0809115323:

Variant ID: vg0809115323 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 9115323
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.74, T: 0.25, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


AAATGCCACGGTAATAATAATAGAAGTCGAACCACTAAAATCACTTACCAAGGAGTGCTCTGACGATGTTTGAAGTAGAATTTGAGTTCGAGGAGAAAAT[T/G]
GTCATAGTGCATAGGTCGTGGACAAAAACAATGAAGATGTCATGAGCAAACACATGTTTTTAAAAGACTCTATTTGCCTCTATTTGTAAAAGACGCAAAG

Reverse complement sequence

CTTTGCGTCTTTTACAAATAGAGGCAAATAGAGTCTTTTAAAAACATGTGTTTGCTCATGACATCTTCATTGTTTTTGTCCACGACCTATGCACTATGAC[A/C]
ATTTTCTCCTCGAACTCAAATTCTACTTCAAACATCGTCAGAGCACTCCTTGGTAAGTGATTTTAGTGGTTCGACTTCTATTATTATTACCGTGGCATTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.50% 40.30% 0.23% 0.04% NA
All Indica  2759 69.00% 30.70% 0.22% 0.07% NA
All Japonica  1512 38.60% 61.20% 0.20% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 69.40% 30.10% 0.34% 0.17% NA
Indica II  465 48.00% 51.60% 0.43% 0.00% NA
Indica III  913 78.60% 21.40% 0.00% 0.00% NA
Indica Intermediate  786 70.10% 29.50% 0.25% 0.13% NA
Temperate Japonica  767 57.60% 42.40% 0.00% 0.00% NA
Tropical Japonica  504 12.70% 87.10% 0.20% 0.00% NA
Japonica Intermediate  241 32.40% 66.80% 0.83% 0.00% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 48.90% 48.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0809115323 T -> G LOC_Os08g15070.1 upstream_gene_variant ; 3614.0bp to feature; MODIFIER silent_mutation Average:36.587; most accessible tissue: Zhenshan97 young leaf, score: 72.747 N N N N
vg0809115323 T -> G LOC_Os08g15070-LOC_Os08g15080 intergenic_region ; MODIFIER silent_mutation Average:36.587; most accessible tissue: Zhenshan97 young leaf, score: 72.747 N N N N
vg0809115323 T -> DEL N N silent_mutation Average:36.587; most accessible tissue: Zhenshan97 young leaf, score: 72.747 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0809115323 NA 1.53E-06 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809115323 1.92E-06 3.73E-07 mr1452_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809115323 NA 2.56E-06 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251