Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0809115323:

Variant ID: vg0809115323 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 9115323
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.74, T: 0.25, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

AAATGCCACGGTAATAATAATAGAAGTCGAACCACTAAAATCACTTACCAAGGAGTGCTCTGACGATGTTTGAAGTAGAATTTGAGTTCGAGGAGAAAAT[T/G]
GTCATAGTGCATAGGTCGTGGACAAAAACAATGAAGATGTCATGAGCAAACACATGTTTTTAAAAGACTCTATTTGCCTCTATTTGTAAAAGACGCAAAG

Reverse complement sequence

CTTTGCGTCTTTTACAAATAGAGGCAAATAGAGTCTTTTAAAAACATGTGTTTGCTCATGACATCTTCATTGTTTTTGTCCACGACCTATGCACTATGAC[A/C]
ATTTTCTCCTCGAACTCAAATTCTACTTCAAACATCGTCAGAGCACTCCTTGGTAAGTGATTTTAGTGGTTCGACTTCTATTATTATTACCGTGGCATTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.50%	40.30%	0.23%	0.04%	NA
All Indica	2759	69.00%	30.70%	0.22%	0.07%	NA
All Japonica	1512	38.60%	61.20%	0.20%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	69.40%	30.10%	0.34%	0.17%	NA
Indica II	465	48.00%	51.60%	0.43%	0.00%	NA
Indica III	913	78.60%	21.40%	0.00%	0.00%	NA
Indica Intermediate	786	70.10%	29.50%	0.25%	0.13%	NA
Temperate Japonica	767	57.60%	42.40%	0.00%	0.00%	NA
Tropical Japonica	504	12.70%	87.10%	0.20%	0.00%	NA
Japonica Intermediate	241	32.40%	66.80%	0.83%	0.00%	NA
VI/Aromatic	96	11.50%	88.50%	0.00%	0.00%	NA
Intermediate	90	48.90%	48.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0809115323	T -> G	LOC_Os08g15070.1	upstream_gene_variant ; 3614.0bp to feature; MODIFIER	silent_mutation	Average:36.587; most accessible tissue: Zhenshan97 young leaf, score: 72.747	N	N	N	N
vg0809115323	T -> G	LOC_Os08g15070-LOC_Os08g15080	intergenic_region ; MODIFIER	silent_mutation	Average:36.587; most accessible tissue: Zhenshan97 young leaf, score: 72.747	N	N	N	N
vg0809115323	T -> DEL	N	N	silent_mutation	Average:36.587; most accessible tissue: Zhenshan97 young leaf, score: 72.747	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0809115323	NA	1.53E-06	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809115323	1.92E-06	3.73E-07	mr1452_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809115323	NA	2.56E-06	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251