\
| Variant ID: vg0809079907 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 9079907 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGTCTATTGACTCCGCCTATTGATTGTGTGTTGACCGTTAACTATAAAGTAAAAAAGACGTATTTGCCCCTTTGAGTTGTTAGGCATGTACTATAGTTTT[C/T]
CTTCTTTTCAATAGGAGGCAAACCTAATTAGCATGGCGATACGACTGACCACAGGTTTGAAGGATGACATTAGTCAAGGCAAATGACTCAAATGGAGGAT
ATCCTCCATTTGAGTCATTTGCCTTGACTAATGTCATCCTTCAAACCTGTGGTCAGTCGTATCGCCATGCTAATTAGGTTTGCCTCCTATTGAAAAGAAG[G/A]
AAAACTATAGTACATGCCTAACAACTCAAAGGGGCAAATACGTCTTTTTTACTTTATAGTTAACGGTCAACACACAATCAATAGGCGGAGTCAATAGACG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.50% | 3.10% | 1.31% | 2.12% | NA |
| All Indica | 2759 | 99.70% | 0.00% | 0.14% | 0.14% | NA |
| All Japonica | 1512 | 85.40% | 9.70% | 3.57% | 1.39% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.00% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 99.40% | 0.10% | 0.25% | 0.25% | NA |
| Temperate Japonica | 767 | 75.00% | 19.00% | 6.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.40% | 0.00% | 1.19% | 3.37% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.00% | 0.83% | 1.66% | NA |
| VI/Aromatic | 96 | 25.00% | 0.00% | 2.08% | 72.92% | NA |
| Intermediate | 90 | 92.20% | 0.00% | 2.22% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0809079907 | C -> T | LOC_Os08g15030.1 | upstream_gene_variant ; 4024.0bp to feature; MODIFIER | silent_mutation | Average:53.048; most accessible tissue: Zhenshan97 young leaf, score: 76.773 | N | N | N | N |
| vg0809079907 | C -> T | LOC_Os08g15040.1 | upstream_gene_variant ; 1579.0bp to feature; MODIFIER | silent_mutation | Average:53.048; most accessible tissue: Zhenshan97 young leaf, score: 76.773 | N | N | N | N |
| vg0809079907 | C -> T | LOC_Os08g15040.2 | upstream_gene_variant ; 1659.0bp to feature; MODIFIER | silent_mutation | Average:53.048; most accessible tissue: Zhenshan97 young leaf, score: 76.773 | N | N | N | N |
| vg0809079907 | C -> T | LOC_Os08g15030-LOC_Os08g15040 | intergenic_region ; MODIFIER | silent_mutation | Average:53.048; most accessible tissue: Zhenshan97 young leaf, score: 76.773 | N | N | N | N |
| vg0809079907 | C -> DEL | N | N | silent_mutation | Average:53.048; most accessible tissue: Zhenshan97 young leaf, score: 76.773 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0809079907 | 6.27E-08 | NA | mr1002 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809079907 | NA | 2.45E-06 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809079907 | 2.33E-06 | NA | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809079907 | NA | 5.55E-06 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |