\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0809079907:

Variant ID: vg0809079907 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 9079907
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTCTATTGACTCCGCCTATTGATTGTGTGTTGACCGTTAACTATAAAGTAAAAAAGACGTATTTGCCCCTTTGAGTTGTTAGGCATGTACTATAGTTTT[C/T]
CTTCTTTTCAATAGGAGGCAAACCTAATTAGCATGGCGATACGACTGACCACAGGTTTGAAGGATGACATTAGTCAAGGCAAATGACTCAAATGGAGGAT

Reverse complement sequence

ATCCTCCATTTGAGTCATTTGCCTTGACTAATGTCATCCTTCAAACCTGTGGTCAGTCGTATCGCCATGCTAATTAGGTTTGCCTCCTATTGAAAAGAAG[G/A]
AAAACTATAGTACATGCCTAACAACTCAAAGGGGCAAATACGTCTTTTTTACTTTATAGTTAACGGTCAACACACAATCAATAGGCGGAGTCAATAGACG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.50% 3.10% 1.31% 2.12% NA
All Indica  2759 99.70% 0.00% 0.14% 0.14% NA
All Japonica  1512 85.40% 9.70% 3.57% 1.39% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.00% 0.43% 0.00% NA
Indica III  913 99.80% 0.00% 0.00% 0.22% NA
Indica Intermediate  786 99.40% 0.10% 0.25% 0.25% NA
Temperate Japonica  767 75.00% 19.00% 6.00% 0.00% NA
Tropical Japonica  504 95.40% 0.00% 1.19% 3.37% NA
Japonica Intermediate  241 97.50% 0.00% 0.83% 1.66% NA
VI/Aromatic  96 25.00% 0.00% 2.08% 72.92% NA
Intermediate  90 92.20% 0.00% 2.22% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0809079907 C -> T LOC_Os08g15030.1 upstream_gene_variant ; 4024.0bp to feature; MODIFIER silent_mutation Average:53.048; most accessible tissue: Zhenshan97 young leaf, score: 76.773 N N N N
vg0809079907 C -> T LOC_Os08g15040.1 upstream_gene_variant ; 1579.0bp to feature; MODIFIER silent_mutation Average:53.048; most accessible tissue: Zhenshan97 young leaf, score: 76.773 N N N N
vg0809079907 C -> T LOC_Os08g15040.2 upstream_gene_variant ; 1659.0bp to feature; MODIFIER silent_mutation Average:53.048; most accessible tissue: Zhenshan97 young leaf, score: 76.773 N N N N
vg0809079907 C -> T LOC_Os08g15030-LOC_Os08g15040 intergenic_region ; MODIFIER silent_mutation Average:53.048; most accessible tissue: Zhenshan97 young leaf, score: 76.773 N N N N
vg0809079907 C -> DEL N N silent_mutation Average:53.048; most accessible tissue: Zhenshan97 young leaf, score: 76.773 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0809079907 6.27E-08 NA mr1002 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809079907 NA 2.45E-06 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809079907 2.33E-06 NA mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809079907 NA 5.55E-06 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251