\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808934061:

Variant ID: vg0808934061 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 8934061
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACACATTGTCCATATCAACACTCACTTGGAACCAAAATACATATTGGCATACACGGTTTTTAGTTATAGAAATTTAATCTCCACCATTGTAACACCCTA[A/T]
AAATCCAGTTGAAAAAAATCAGTAAAATTTTGAACTTTTAAAAACTTTTGCATCATGCAGTCATCTTTGCTTTCCTTGTGTGGAAATCCACCCTAAAACA

Reverse complement sequence

TGTTTTAGGGTGGATTTCCACACAAGGAAAGCAAAGATGACTGCATGATGCAAAAGTTTTTAAAAGTTCAAAATTTTACTGATTTTTTTCAACTGGATTT[T/A]
TAGGGTGTTACAATGGTGGAGATTAAATTTCTATAACTAAAAACCGTGTATGCCAATATGTATTTTGGTTCCAAGTGAGTGTTGATATGGACAATGTGTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.30% 15.70% 0.17% 3.81% NA
All Indica  2759 72.60% 22.80% 0.22% 4.35% NA
All Japonica  1512 99.70% 0.10% 0.00% 0.13% NA
Aus  269 62.10% 37.90% 0.00% 0.00% NA
Indica I  595 91.60% 8.40% 0.00% 0.00% NA
Indica II  465 92.00% 6.20% 0.22% 1.51% NA
Indica III  913 49.50% 40.20% 0.33% 9.97% NA
Indica Intermediate  786 73.70% 23.30% 0.25% 2.80% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.00% 0.00% 0.83% NA
VI/Aromatic  96 39.60% 6.20% 1.04% 53.12% NA
Intermediate  90 85.60% 5.60% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0808934061 A -> T LOC_Os08g14840.1 downstream_gene_variant ; 543.0bp to feature; MODIFIER silent_mutation Average:63.958; most accessible tissue: Callus, score: 84.922 N N N N
vg0808934061 A -> T LOC_Os08g14830-LOC_Os08g14840 intergenic_region ; MODIFIER silent_mutation Average:63.958; most accessible tissue: Callus, score: 84.922 N N N N
vg0808934061 A -> DEL N N silent_mutation Average:63.958; most accessible tissue: Callus, score: 84.922 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0808934061 NA 1.17E-08 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808934061 NA 5.63E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808934061 NA 1.73E-08 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808934061 NA 8.28E-08 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808934061 NA 9.32E-07 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808934061 NA 7.06E-06 mr1418 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808934061 NA 1.94E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808934061 4.78E-06 4.78E-06 mr1802 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808934061 NA 2.71E-07 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808934061 NA 7.51E-08 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808934061 NA 3.76E-08 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808934061 NA 4.44E-08 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251