\
| Variant ID: vg0808934061 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 8934061 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TACACATTGTCCATATCAACACTCACTTGGAACCAAAATACATATTGGCATACACGGTTTTTAGTTATAGAAATTTAATCTCCACCATTGTAACACCCTA[A/T]
AAATCCAGTTGAAAAAAATCAGTAAAATTTTGAACTTTTAAAAACTTTTGCATCATGCAGTCATCTTTGCTTTCCTTGTGTGGAAATCCACCCTAAAACA
TGTTTTAGGGTGGATTTCCACACAAGGAAAGCAAAGATGACTGCATGATGCAAAAGTTTTTAAAAGTTCAAAATTTTACTGATTTTTTTCAACTGGATTT[T/A]
TAGGGTGTTACAATGGTGGAGATTAAATTTCTATAACTAAAAACCGTGTATGCCAATATGTATTTTGGTTCCAAGTGAGTGTTGATATGGACAATGTGTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.30% | 15.70% | 0.17% | 3.81% | NA |
| All Indica | 2759 | 72.60% | 22.80% | 0.22% | 4.35% | NA |
| All Japonica | 1512 | 99.70% | 0.10% | 0.00% | 0.13% | NA |
| Aus | 269 | 62.10% | 37.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.60% | 8.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.00% | 6.20% | 0.22% | 1.51% | NA |
| Indica III | 913 | 49.50% | 40.20% | 0.33% | 9.97% | NA |
| Indica Intermediate | 786 | 73.70% | 23.30% | 0.25% | 2.80% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 39.60% | 6.20% | 1.04% | 53.12% | NA |
| Intermediate | 90 | 85.60% | 5.60% | 1.11% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0808934061 | A -> T | LOC_Os08g14840.1 | downstream_gene_variant ; 543.0bp to feature; MODIFIER | silent_mutation | Average:63.958; most accessible tissue: Callus, score: 84.922 | N | N | N | N |
| vg0808934061 | A -> T | LOC_Os08g14830-LOC_Os08g14840 | intergenic_region ; MODIFIER | silent_mutation | Average:63.958; most accessible tissue: Callus, score: 84.922 | N | N | N | N |
| vg0808934061 | A -> DEL | N | N | silent_mutation | Average:63.958; most accessible tissue: Callus, score: 84.922 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0808934061 | NA | 1.17E-08 | mr1063 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808934061 | NA | 5.63E-06 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808934061 | NA | 1.73E-08 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808934061 | NA | 8.28E-08 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808934061 | NA | 9.32E-07 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808934061 | NA | 7.06E-06 | mr1418 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808934061 | NA | 1.94E-07 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808934061 | 4.78E-06 | 4.78E-06 | mr1802 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808934061 | NA | 2.71E-07 | mr1803 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808934061 | NA | 7.51E-08 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808934061 | NA | 3.76E-08 | mr1180_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808934061 | NA | 4.44E-08 | mr1183_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |