Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808836774:

Variant ID: vg0808836774 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 8836774
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTTGGAAACCGGGACTAAAGGGGGGTTACAAACCGGGACTACAAAGGGTTTCTCCACCAGTGAAATGCGAGCACCCGTGTCAAATCTACGACTTGAACC[C/T]
AGGTAAGCAAGTTCCACCACAAGGAAGCTAATGATCAGTTCAGCTACGTTCACTTCGTCATTAAAGGTAGGTTGTAGAACTGATGATCTGTCAATGGTGA

Reverse complement sequence

TCACCATTGACAGATCATCAGTTCTACAACCTACCTTTAATGACGAAGTGAACGTAGCTGAACTGATCATTAGCTTCCTTGTGGTGGAACTTGCTTACCT[G/A]
GGTTCAAGTCGTAGATTTGACACGGGTGCTCGCATTTCACTGGTGGAGAAACCCTTTGTAGTCCCGGTTTGTAACCCCCCTTTAGTCCCGGTTTCCAAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.00%	1.10%	0.83%	58.02%	NA
All Indica	2759	15.90%	1.90%	1.30%	80.86%	NA
All Japonica	1512	86.40%	0.00%	0.00%	13.62%	NA
Aus	269	38.30%	0.40%	0.74%	60.59%	NA
Indica I	595	24.70%	0.80%	1.68%	72.77%	NA
Indica II	465	3.00%	0.00%	1.29%	95.70%	NA
Indica III	913	21.40%	3.30%	0.66%	74.70%	NA
Indica Intermediate	786	10.70%	2.20%	1.78%	85.37%	NA
Temperate Japonica	767	95.40%	0.00%	0.00%	4.56%	NA
Tropical Japonica	504	77.00%	0.00%	0.00%	23.02%	NA
Japonica Intermediate	241	77.20%	0.00%	0.00%	22.82%	NA
VI/Aromatic	96	12.50%	0.00%	0.00%	87.50%	NA
Intermediate	90	34.40%	0.00%	1.11%	64.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0808836774	C -> T	LOC_Os08g14700.1	upstream_gene_variant ; 481.0bp to feature; MODIFIER	silent_mutation	Average:18.018; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0808836774	C -> T	LOC_Os08g14710.1	upstream_gene_variant ; 4194.0bp to feature; MODIFIER	silent_mutation	Average:18.018; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0808836774	C -> T	LOC_Os08g14690.1	downstream_gene_variant ; 572.0bp to feature; MODIFIER	silent_mutation	Average:18.018; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0808836774	C -> T	LOC_Os08g14690-LOC_Os08g14700	intergenic_region ; MODIFIER	silent_mutation	Average:18.018; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0808836774	C -> DEL	N	N	silent_mutation	Average:18.018; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0808836774	NA	1.66E-07	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808836774	NA	2.01E-08	mr1511_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808836774	7.89E-06	NA	mr1557_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808836774	NA	3.34E-06	mr1638_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808836774	NA	3.75E-06	mr1729_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808836774	NA	2.52E-07	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251