\
| Variant ID: vg0808836774 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 8836774 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTTTGGAAACCGGGACTAAAGGGGGGTTACAAACCGGGACTACAAAGGGTTTCTCCACCAGTGAAATGCGAGCACCCGTGTCAAATCTACGACTTGAACC[C/T]
AGGTAAGCAAGTTCCACCACAAGGAAGCTAATGATCAGTTCAGCTACGTTCACTTCGTCATTAAAGGTAGGTTGTAGAACTGATGATCTGTCAATGGTGA
TCACCATTGACAGATCATCAGTTCTACAACCTACCTTTAATGACGAAGTGAACGTAGCTGAACTGATCATTAGCTTCCTTGTGGTGGAACTTGCTTACCT[G/A]
GGTTCAAGTCGTAGATTTGACACGGGTGCTCGCATTTCACTGGTGGAGAAACCCTTTGTAGTCCCGGTTTGTAACCCCCCTTTAGTCCCGGTTTCCAAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.00% | 1.10% | 0.83% | 58.02% | NA |
| All Indica | 2759 | 15.90% | 1.90% | 1.30% | 80.86% | NA |
| All Japonica | 1512 | 86.40% | 0.00% | 0.00% | 13.62% | NA |
| Aus | 269 | 38.30% | 0.40% | 0.74% | 60.59% | NA |
| Indica I | 595 | 24.70% | 0.80% | 1.68% | 72.77% | NA |
| Indica II | 465 | 3.00% | 0.00% | 1.29% | 95.70% | NA |
| Indica III | 913 | 21.40% | 3.30% | 0.66% | 74.70% | NA |
| Indica Intermediate | 786 | 10.70% | 2.20% | 1.78% | 85.37% | NA |
| Temperate Japonica | 767 | 95.40% | 0.00% | 0.00% | 4.56% | NA |
| Tropical Japonica | 504 | 77.00% | 0.00% | 0.00% | 23.02% | NA |
| Japonica Intermediate | 241 | 77.20% | 0.00% | 0.00% | 22.82% | NA |
| VI/Aromatic | 96 | 12.50% | 0.00% | 0.00% | 87.50% | NA |
| Intermediate | 90 | 34.40% | 0.00% | 1.11% | 64.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0808836774 | C -> T | LOC_Os08g14700.1 | upstream_gene_variant ; 481.0bp to feature; MODIFIER | silent_mutation | Average:18.018; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0808836774 | C -> T | LOC_Os08g14710.1 | upstream_gene_variant ; 4194.0bp to feature; MODIFIER | silent_mutation | Average:18.018; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0808836774 | C -> T | LOC_Os08g14690.1 | downstream_gene_variant ; 572.0bp to feature; MODIFIER | silent_mutation | Average:18.018; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0808836774 | C -> T | LOC_Os08g14690-LOC_Os08g14700 | intergenic_region ; MODIFIER | silent_mutation | Average:18.018; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0808836774 | C -> DEL | N | N | silent_mutation | Average:18.018; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0808836774 | NA | 1.66E-07 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808836774 | NA | 2.01E-08 | mr1511_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808836774 | 7.89E-06 | NA | mr1557_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808836774 | NA | 3.34E-06 | mr1638_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808836774 | NA | 3.75E-06 | mr1729_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808836774 | NA | 2.52E-07 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |