\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808836774:

Variant ID: vg0808836774 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 8836774
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTTGGAAACCGGGACTAAAGGGGGGTTACAAACCGGGACTACAAAGGGTTTCTCCACCAGTGAAATGCGAGCACCCGTGTCAAATCTACGACTTGAACC[C/T]
AGGTAAGCAAGTTCCACCACAAGGAAGCTAATGATCAGTTCAGCTACGTTCACTTCGTCATTAAAGGTAGGTTGTAGAACTGATGATCTGTCAATGGTGA

Reverse complement sequence

TCACCATTGACAGATCATCAGTTCTACAACCTACCTTTAATGACGAAGTGAACGTAGCTGAACTGATCATTAGCTTCCTTGTGGTGGAACTTGCTTACCT[G/A]
GGTTCAAGTCGTAGATTTGACACGGGTGCTCGCATTTCACTGGTGGAGAAACCCTTTGTAGTCCCGGTTTGTAACCCCCCTTTAGTCCCGGTTTCCAAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.00% 1.10% 0.83% 58.02% NA
All Indica  2759 15.90% 1.90% 1.30% 80.86% NA
All Japonica  1512 86.40% 0.00% 0.00% 13.62% NA
Aus  269 38.30% 0.40% 0.74% 60.59% NA
Indica I  595 24.70% 0.80% 1.68% 72.77% NA
Indica II  465 3.00% 0.00% 1.29% 95.70% NA
Indica III  913 21.40% 3.30% 0.66% 74.70% NA
Indica Intermediate  786 10.70% 2.20% 1.78% 85.37% NA
Temperate Japonica  767 95.40% 0.00% 0.00% 4.56% NA
Tropical Japonica  504 77.00% 0.00% 0.00% 23.02% NA
Japonica Intermediate  241 77.20% 0.00% 0.00% 22.82% NA
VI/Aromatic  96 12.50% 0.00% 0.00% 87.50% NA
Intermediate  90 34.40% 0.00% 1.11% 64.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0808836774 C -> T LOC_Os08g14700.1 upstream_gene_variant ; 481.0bp to feature; MODIFIER silent_mutation Average:18.018; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0808836774 C -> T LOC_Os08g14710.1 upstream_gene_variant ; 4194.0bp to feature; MODIFIER silent_mutation Average:18.018; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0808836774 C -> T LOC_Os08g14690.1 downstream_gene_variant ; 572.0bp to feature; MODIFIER silent_mutation Average:18.018; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0808836774 C -> T LOC_Os08g14690-LOC_Os08g14700 intergenic_region ; MODIFIER silent_mutation Average:18.018; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0808836774 C -> DEL N N silent_mutation Average:18.018; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0808836774 NA 1.66E-07 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808836774 NA 2.01E-08 mr1511_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808836774 7.89E-06 NA mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808836774 NA 3.34E-06 mr1638_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808836774 NA 3.75E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808836774 NA 2.52E-07 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251