\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808821102:

Variant ID: vg0808821102 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 8821102
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGTACATATATTTTGGTAGTTTAGTTATACAAAACCACACTATCGATGAATGTATTCACCCATGAGATATCGTGGTTGTTCCATCAAGGATGAGGACGT[T/G]
GCATCCTATTAATTTCATGCGATGGCTGGTAATAGGATGCCATGTCCTCATCCTAGGTGAAACAGTCACGTCATCTCGCGGGTGAATCCATTCATTCATA

Reverse complement sequence

TATGAATGAATGGATTCACCCGCGAGATGACGTGACTGTTTCACCTAGGATGAGGACATGGCATCCTATTACCAGCCATCGCATGAAATTAATAGGATGC[A/C]
ACGTCCTCATCCTTGATGGAACAACCACGATATCTCATGGGTGAATACATTCATCGATAGTGTGGTTTTGTATAACTAAACTACCAAAATATATGTACTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.00% 16.20% 0.57% 8.19% NA
All Indica  2759 90.40% 3.40% 0.69% 5.55% NA
All Japonica  1512 46.00% 43.70% 0.13% 10.12% NA
Aus  269 88.80% 0.00% 0.00% 11.15% NA
Indica I  595 79.00% 13.60% 0.34% 7.06% NA
Indica II  465 91.40% 0.90% 1.08% 6.67% NA
Indica III  913 96.10% 0.10% 0.11% 3.72% NA
Indica Intermediate  786 91.90% 0.90% 1.40% 5.85% NA
Temperate Japonica  767 21.10% 75.00% 0.13% 3.78% NA
Tropical Japonica  504 80.20% 5.80% 0.20% 13.89% NA
Japonica Intermediate  241 53.90% 23.70% 0.00% 22.41% NA
VI/Aromatic  96 58.30% 0.00% 4.17% 37.50% NA
Intermediate  90 66.70% 14.40% 2.22% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0808821102 T -> G LOC_Os08g14660.1 upstream_gene_variant ; 4403.0bp to feature; MODIFIER silent_mutation Average:21.916; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0808821102 T -> G LOC_Os08g14670.1 upstream_gene_variant ; 1514.0bp to feature; MODIFIER silent_mutation Average:21.916; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0808821102 T -> G LOC_Os08g14660-LOC_Os08g14670 intergenic_region ; MODIFIER silent_mutation Average:21.916; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0808821102 T -> DEL N N silent_mutation Average:21.916; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0808821102 2.31E-07 6.79E-34 mr1137 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808821102 NA 2.89E-11 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808821102 NA 1.56E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808821102 NA 1.22E-11 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808821102 NA 2.30E-07 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251