Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808781519:

Variant ID: vg0808781519 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 8781519
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

TCTCTCTCTAAAACACGCATTCTCTCTCTTATTTTACTCTCTAAAACACGCACTGTCTCCCTCTCTCTAGAAGTAGAAGTACTCCCTCCATACCTATAAA[A/G]
AAAATCGTTTAGGATATCGATACGGTCTCCAAAACGCAACTTTAACTTCTTAATTCTATAAAAATATTTATTGAAAAGTGATATATGTATACTTTTATGA

Reverse complement sequence

TCATAAAAGTATACATATATCACTTTTCAATAAATATTTTTATAGAATTAAGAAGTTAAAGTTGCGTTTTGGAGACCGTATCGATATCCTAAACGATTTT[T/C]
TTTATAGGTATGGAGGGAGTACTTCTACTTCTAGAGAGAGGGAGACAGTGCGTGTTTTAGAGAGTAAAATAAGAGAGAGAATGCGTGTTTTAGAGAGAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.30%	17.50%	0.34%	19.91%	NA
All Indica	2759	66.40%	3.40%	0.25%	29.97%	NA
All Japonica	1512	56.70%	42.60%	0.46%	0.26%	NA
Aus	269	63.60%	0.70%	0.00%	35.69%	NA
Indica I	595	61.00%	11.90%	0.50%	26.55%	NA
Indica II	465	66.70%	0.40%	0.43%	32.47%	NA
Indica III	913	63.50%	0.80%	0.00%	35.71%	NA
Indica Intermediate	786	73.50%	1.80%	0.25%	24.43%	NA
Temperate Japonica	767	29.10%	70.00%	0.91%	0.00%	NA
Tropical Japonica	504	91.70%	8.10%	0.00%	0.20%	NA
Japonica Intermediate	241	71.40%	27.40%	0.00%	1.24%	NA
VI/Aromatic	96	19.80%	74.00%	0.00%	6.25%	NA
Intermediate	90	71.10%	17.80%	2.22%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0808781519	A -> G	LOC_Os08g14600.1	upstream_gene_variant ; 361.0bp to feature; MODIFIER	silent_mutation	Average:49.891; most accessible tissue: Callus, score: 93.878	N	N	N	N
vg0808781519	A -> G	LOC_Os08g14610.1	downstream_gene_variant ; 2921.0bp to feature; MODIFIER	silent_mutation	Average:49.891; most accessible tissue: Callus, score: 93.878	N	N	N	N
vg0808781519	A -> G	LOC_Os08g14590-LOC_Os08g14600	intergenic_region ; MODIFIER	silent_mutation	Average:49.891; most accessible tissue: Callus, score: 93.878	N	N	N	N
vg0808781519	A -> DEL	N	N	silent_mutation	Average:49.891; most accessible tissue: Callus, score: 93.878	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0808781519	A	G	-0.09	-0.05	-0.05	-0.05	-0.04	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0808781519	NA	2.11E-06	mr1069	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808781519	NA	9.45E-06	mr1077	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808781519	4.34E-06	1.38E-16	mr1137	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808781519	NA	3.30E-06	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808781519	NA	6.59E-06	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808781519	NA	9.12E-08	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808781519	NA	9.77E-07	mr1338	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808781519	NA	2.67E-06	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808781519	NA	2.81E-12	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808781519	NA	5.65E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808781519	NA	6.85E-07	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808781519	NA	1.91E-10	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808781519	NA	6.71E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251