\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808781519:

Variant ID: vg0808781519 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 8781519
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TCTCTCTCTAAAACACGCATTCTCTCTCTTATTTTACTCTCTAAAACACGCACTGTCTCCCTCTCTCTAGAAGTAGAAGTACTCCCTCCATACCTATAAA[A/G]
AAAATCGTTTAGGATATCGATACGGTCTCCAAAACGCAACTTTAACTTCTTAATTCTATAAAAATATTTATTGAAAAGTGATATATGTATACTTTTATGA

Reverse complement sequence

TCATAAAAGTATACATATATCACTTTTCAATAAATATTTTTATAGAATTAAGAAGTTAAAGTTGCGTTTTGGAGACCGTATCGATATCCTAAACGATTTT[T/C]
TTTATAGGTATGGAGGGAGTACTTCTACTTCTAGAGAGAGGGAGACAGTGCGTGTTTTAGAGAGTAAAATAAGAGAGAGAATGCGTGTTTTAGAGAGAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.30% 17.50% 0.34% 19.91% NA
All Indica  2759 66.40% 3.40% 0.25% 29.97% NA
All Japonica  1512 56.70% 42.60% 0.46% 0.26% NA
Aus  269 63.60% 0.70% 0.00% 35.69% NA
Indica I  595 61.00% 11.90% 0.50% 26.55% NA
Indica II  465 66.70% 0.40% 0.43% 32.47% NA
Indica III  913 63.50% 0.80% 0.00% 35.71% NA
Indica Intermediate  786 73.50% 1.80% 0.25% 24.43% NA
Temperate Japonica  767 29.10% 70.00% 0.91% 0.00% NA
Tropical Japonica  504 91.70% 8.10% 0.00% 0.20% NA
Japonica Intermediate  241 71.40% 27.40% 0.00% 1.24% NA
VI/Aromatic  96 19.80% 74.00% 0.00% 6.25% NA
Intermediate  90 71.10% 17.80% 2.22% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0808781519 A -> G LOC_Os08g14600.1 upstream_gene_variant ; 361.0bp to feature; MODIFIER silent_mutation Average:49.891; most accessible tissue: Callus, score: 93.878 N N N N
vg0808781519 A -> G LOC_Os08g14610.1 downstream_gene_variant ; 2921.0bp to feature; MODIFIER silent_mutation Average:49.891; most accessible tissue: Callus, score: 93.878 N N N N
vg0808781519 A -> G LOC_Os08g14590-LOC_Os08g14600 intergenic_region ; MODIFIER silent_mutation Average:49.891; most accessible tissue: Callus, score: 93.878 N N N N
vg0808781519 A -> DEL N N silent_mutation Average:49.891; most accessible tissue: Callus, score: 93.878 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0808781519 A G -0.09 -0.05 -0.05 -0.05 -0.04 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0808781519 NA 2.11E-06 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808781519 NA 9.45E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808781519 4.34E-06 1.38E-16 mr1137 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808781519 NA 3.30E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808781519 NA 6.59E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808781519 NA 9.12E-08 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808781519 NA 9.77E-07 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808781519 NA 2.67E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808781519 NA 2.81E-12 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808781519 NA 5.65E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808781519 NA 6.85E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808781519 NA 1.91E-10 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808781519 NA 6.71E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251