Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808770697:

Variant ID: vg0808770697 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 8770697
Reference Allele: G	Alternative Allele: A,C
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.64, A: 0.35, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

CTAAAACTATAGGCTTATATTAATAGGTTTTACATAGAAGAGCTAGCTTAACACAAGCTTCAAGACAAATACATTAAATGTATAAGTGAGATAGAGAGAG[G/A,C]
AGAAGAATATTGTAGCCAACCTTATAGCTAATCTATTATATATGTTGGCTTTAAAATAGGCTAATAGTAGAAAGTGAGCTCTACTATTATCCTTGCTCTG

Reverse complement sequence

CAGAGCAAGGATAATAGTAGAGCTCACTTTCTACTATTAGCCTATTTTAAAGCCAACATATATAATAGATTAGCTATAAGGTTGGCTACAATATTCTTCT[C/T,G]
CTCTCTCTATCTCACTTATACATTTAATGTATTTGTCTTGAAGCTTGTGTTAAGCTAGCTCTTCTATGTAAAACCTATTAATATAAGCCTATAGTTTTAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.30%	12.60%	0.04%	0.00%	C: 0.02%
All Indica	2759	87.60%	12.40%	0.04%	0.00%	C: 0.04%
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	40.90%	59.10%	0.00%	0.00%	NA
Indica I	595	78.70%	21.20%	0.17%	0.00%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	86.50%	13.50%	0.00%	0.00%	NA
Indica Intermediate	786	89.70%	10.20%	0.00%	0.00%	C: 0.13%
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	20.80%	79.20%	0.00%	0.00%	NA
Intermediate	90	83.30%	15.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0808770697	G -> C	LOC_Os08g14590.1	upstream_gene_variant ; 3629.0bp to feature; MODIFIER	silent_mutation	Average:66.194; most accessible tissue: Minghui63 flag leaf, score: 79.383	N	N	N	N
vg0808770697	G -> C	LOC_Os08g14580.1	intron_variant ; MODIFIER	silent_mutation	Average:66.194; most accessible tissue: Minghui63 flag leaf, score: 79.383	N	N	N	N
vg0808770697	G -> A	LOC_Os08g14590.1	upstream_gene_variant ; 3629.0bp to feature; MODIFIER	silent_mutation	Average:66.194; most accessible tissue: Minghui63 flag leaf, score: 79.383	N	N	N	N
vg0808770697	G -> A	LOC_Os08g14580.1	intron_variant ; MODIFIER	silent_mutation	Average:66.194; most accessible tissue: Minghui63 flag leaf, score: 79.383	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0808770697	NA	6.70E-07	mr1201	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808770697	NA	1.56E-06	mr1201	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808770697	NA	8.36E-08	mr1219	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808770697	NA	1.66E-06	mr1274	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808770697	4.26E-06	NA	mr1697	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808770697	NA	5.68E-06	mr1570_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251