\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808728664:

Variant ID: vg0808728664 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 8728664
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTAAATTATATTTATATCCACTTTGTGATCCATTGTACTCCTTTAATTAAATGAAATATTTATGTCTTATAAAAGTTATACTATGGTCCTAAATACATC[G/A]
CTGCCCATGGGATCGAAATATAATAATTAATGTTGATAATTTTAAATAATTTCACATCATATTTTAGAGTGTCAAATATCACTTGATAAATATACAACAT

Reverse complement sequence

ATGTTGTATATTTATCAAGTGATATTTGACACTCTAAAATATGATGTGAAATTATTTAAAATTATCAACATTAATTATTATATTTCGATCCCATGGGCAG[C/T]
GATGTATTTAGGACCATAGTATAACTTTTATAAGACATAAATATTTCATTTAATTAAAGGAGTACAATGGATCACAAAGTGGATATAAATATAATTTAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.80% 6.70% 3.45% 0.00% NA
All Indica  2759 97.00% 1.10% 1.96% 0.00% NA
All Japonica  1512 74.40% 18.80% 6.81% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 91.30% 2.70% 6.05% 0.00% NA
Indica II  465 97.40% 1.10% 1.51% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 97.50% 1.10% 1.40% 0.00% NA
Temperate Japonica  767 55.90% 32.30% 11.73% 0.00% NA
Tropical Japonica  504 94.00% 5.00% 0.99% 0.00% NA
Japonica Intermediate  241 92.10% 4.60% 3.32% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 3.30% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0808728664 G -> A LOC_Os08g14530.1 upstream_gene_variant ; 3301.0bp to feature; MODIFIER silent_mutation Average:26.467; most accessible tissue: Callus, score: 34.656 N N N N
vg0808728664 G -> A LOC_Os08g14510.1 downstream_gene_variant ; 3272.0bp to feature; MODIFIER silent_mutation Average:26.467; most accessible tissue: Callus, score: 34.656 N N N N
vg0808728664 G -> A LOC_Os08g14520.1 downstream_gene_variant ; 1839.0bp to feature; MODIFIER silent_mutation Average:26.467; most accessible tissue: Callus, score: 34.656 N N N N
vg0808728664 G -> A LOC_Os08g14520-LOC_Os08g14530 intergenic_region ; MODIFIER silent_mutation Average:26.467; most accessible tissue: Callus, score: 34.656 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0808728664 NA 2.28E-06 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808728664 NA 5.23E-06 mr1075 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808728664 NA 4.32E-07 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808728664 NA 7.77E-07 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808728664 NA 3.56E-06 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808728664 NA 7.84E-09 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808728664 NA 7.57E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808728664 NA 6.15E-07 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808728664 NA 2.65E-06 mr1658 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808728664 1.89E-07 1.89E-07 mr1728 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808728664 NA 4.93E-06 mr1768 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808728664 NA 1.49E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808728664 NA 1.88E-07 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808728664 NA 1.27E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251