\
| Variant ID: vg0808728664 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 8728664 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TTTAAATTATATTTATATCCACTTTGTGATCCATTGTACTCCTTTAATTAAATGAAATATTTATGTCTTATAAAAGTTATACTATGGTCCTAAATACATC[G/A]
CTGCCCATGGGATCGAAATATAATAATTAATGTTGATAATTTTAAATAATTTCACATCATATTTTAGAGTGTCAAATATCACTTGATAAATATACAACAT
ATGTTGTATATTTATCAAGTGATATTTGACACTCTAAAATATGATGTGAAATTATTTAAAATTATCAACATTAATTATTATATTTCGATCCCATGGGCAG[C/T]
GATGTATTTAGGACCATAGTATAACTTTTATAAGACATAAATATTTCATTTAATTAAAGGAGTACAATGGATCACAAAGTGGATATAAATATAATTTAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.80% | 6.70% | 3.45% | 0.00% | NA |
| All Indica | 2759 | 97.00% | 1.10% | 1.96% | 0.00% | NA |
| All Japonica | 1512 | 74.40% | 18.80% | 6.81% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.30% | 2.70% | 6.05% | 0.00% | NA |
| Indica II | 465 | 97.40% | 1.10% | 1.51% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.50% | 1.10% | 1.40% | 0.00% | NA |
| Temperate Japonica | 767 | 55.90% | 32.30% | 11.73% | 0.00% | NA |
| Tropical Japonica | 504 | 94.00% | 5.00% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.10% | 4.60% | 3.32% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 3.30% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0808728664 | G -> A | LOC_Os08g14530.1 | upstream_gene_variant ; 3301.0bp to feature; MODIFIER | silent_mutation | Average:26.467; most accessible tissue: Callus, score: 34.656 | N | N | N | N |
| vg0808728664 | G -> A | LOC_Os08g14510.1 | downstream_gene_variant ; 3272.0bp to feature; MODIFIER | silent_mutation | Average:26.467; most accessible tissue: Callus, score: 34.656 | N | N | N | N |
| vg0808728664 | G -> A | LOC_Os08g14520.1 | downstream_gene_variant ; 1839.0bp to feature; MODIFIER | silent_mutation | Average:26.467; most accessible tissue: Callus, score: 34.656 | N | N | N | N |
| vg0808728664 | G -> A | LOC_Os08g14520-LOC_Os08g14530 | intergenic_region ; MODIFIER | silent_mutation | Average:26.467; most accessible tissue: Callus, score: 34.656 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0808728664 | NA | 2.28E-06 | mr1069 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808728664 | NA | 5.23E-06 | mr1075 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808728664 | NA | 4.32E-07 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808728664 | NA | 7.77E-07 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808728664 | NA | 3.56E-06 | mr1282 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808728664 | NA | 7.84E-09 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808728664 | NA | 7.57E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808728664 | NA | 6.15E-07 | mr1650 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808728664 | NA | 2.65E-06 | mr1658 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808728664 | 1.89E-07 | 1.89E-07 | mr1728 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808728664 | NA | 4.93E-06 | mr1768 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808728664 | NA | 1.49E-06 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808728664 | NA | 1.88E-07 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808728664 | NA | 1.27E-06 | mr1282_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |