Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808585110:

Variant ID: vg0808585110 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 8585110
Reference Allele: G	Alternative Allele: A,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

TCACTTCACTCACACACCTCAAGCAATAGCTCTCTCATTTCTCTCAAGTTTAGTCTAGCAATATCTAGCTGGTGGAATAGGAATAGAGTAGAAATCAGGA[G/A,T]
TCCGGAAGCCTTCGGAAGAGTTCAGGTATGGCTCTAGTAGCTTTTCTCTTCTCTTTTGTAAGTTTTGTACTTTTATTAGAATACTCTTCTAAATATATTT

Reverse complement sequence

AAATATATTTAGAAGAGTATTCTAATAAAAGTACAAAACTTACAAAAGAGAAGAGAAAAGCTACTAGAGCCATACCTGAACTCTTCCGAAGGCTTCCGGA[C/T,A]
TCCTGATTTCTACTCTATTCCTATTCCACCAGCTAGATATTGCTAGACTAAACTTGAGAGAAATGAGAGAGCTATTGCTTGAGGTGTGTGAGTGAAGTGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.00%	12.10%	1.88%	0.00%	NA
All Indica	2759	79.40%	18.10%	2.50%	0.00%	NA
All Japonica	1512	95.00%	3.80%	1.12%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	69.70%	26.90%	3.36%	0.00%	NA
Indica II	465	66.20%	29.50%	4.30%	0.00%	NA
Indica III	913	98.90%	1.00%	0.11%	0.00%	NA
Indica Intermediate	786	71.90%	24.60%	3.56%	0.00%	NA
Temperate Japonica	767	91.10%	6.90%	1.96%	0.00%	NA
Tropical Japonica	504	99.00%	0.60%	0.40%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	78.90%	17.80%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0808585110	G -> T	LOC_Os08g14320.1	downstream_gene_variant ; 1005.0bp to feature; MODIFIER	N	Average:48.824; most accessible tissue: Zhenshan97 flower, score: 70.106	N	N	N	N
vg0808585110	G -> T	LOC_Os08g14330.1	downstream_gene_variant ; 3927.0bp to feature; MODIFIER	N	Average:48.824; most accessible tissue: Zhenshan97 flower, score: 70.106	N	N	N	N
vg0808585110	G -> T	LOC_Os08g14320-LOC_Os08g14330	intergenic_region ; MODIFIER	N	Average:48.824; most accessible tissue: Zhenshan97 flower, score: 70.106	N	N	N	N
vg0808585110	G -> A	LOC_Os08g14320.1	downstream_gene_variant ; 1005.0bp to feature; MODIFIER	silent_mutation	Average:48.824; most accessible tissue: Zhenshan97 flower, score: 70.106	N	N	N	N
vg0808585110	G -> A	LOC_Os08g14330.1	downstream_gene_variant ; 3927.0bp to feature; MODIFIER	silent_mutation	Average:48.824; most accessible tissue: Zhenshan97 flower, score: 70.106	N	N	N	N
vg0808585110	G -> A	LOC_Os08g14320-LOC_Os08g14330	intergenic_region ; MODIFIER	silent_mutation	Average:48.824; most accessible tissue: Zhenshan97 flower, score: 70.106	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0808585110	8.07E-06	8.07E-06	mr1369	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808585110	4.32E-06	4.32E-06	mr1373	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808585110	NA	3.39E-06	mr1648	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808585110	NA	1.46E-06	mr1652	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808585110	NA	7.90E-06	mr1697	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251