\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808574594:

Variant ID: vg0808574594 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 8574594
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.21, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


GACGTGCAGACCTGCGACTACAAGGATGTGCAGGTCATGTTCGAGATGCTGACGTCGGAGCTGGAGGCCCAGAAGCAGCAGCAGCAGCTGCTGCCGCCGT[C/T]
GCCGCGCAAGCCGGCGTGGCCCGGCAGCTCGCCGTCGCCGGCCCCGGCGAAGCAGTAGAGACAACAAGAACAGCAAGAAGATGATGAGGAGACCGTGCGC

Reverse complement sequence

GCGCACGGTCTCCTCATCATCTTCTTGCTGTTCTTGTTGTCTCTACTGCTTCGCCGGGGCCGGCGACGGCGAGCTGCCGGGCCACGCCGGCTTGCGCGGC[G/A]
ACGGCGGCAGCAGCTGCTGCTGCTGCTTCTGGGCCTCCAGCTCCGACGTCAGCATCTCGAACATGACCTGCACATCCTTGTAGTCGCAGGTCTGCACGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.30% 45.50% 0.19% 0.00% NA
All Indica  2759 32.80% 66.90% 0.22% 0.00% NA
All Japonica  1512 88.40% 11.60% 0.07% 0.00% NA
Aus  269 66.20% 33.50% 0.37% 0.00% NA
Indica I  595 36.80% 62.70% 0.50% 0.00% NA
Indica II  465 67.50% 32.30% 0.22% 0.00% NA
Indica III  913 3.60% 96.40% 0.00% 0.00% NA
Indica Intermediate  786 43.30% 56.50% 0.25% 0.00% NA
Temperate Japonica  767 98.40% 1.40% 0.13% 0.00% NA
Tropical Japonica  504 75.80% 24.20% 0.00% 0.00% NA
Japonica Intermediate  241 82.60% 17.40% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 63.30% 35.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0808574594 C -> T LOC_Os08g14310.1 missense_variant ; p.Ser73Leu; MODERATE nonsynonymous_codon ; S73L Average:80.297; most accessible tissue: Zhenshan97 panicle, score: 87.126 unknown unknown TOLERATED 0.25

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0808574594 C T 0.0 -0.01 -0.01 0.0 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0808574594 9.26E-06 NA mr1223_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808574594 NA 2.93E-07 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251