\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808474802:

Variant ID: vg0808474802 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 8474802
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


ACGAAAACGACCGGATATGATTCAAAACTAAGATTCCCCTTAGTAAAATAATATTACCTCCGTCCCAAAATAAGTGCAGCCGTGGATATCCGTGTCCAAC[G/A]
TTTGACCGTATGTCTTATTTGAAAATTTTGAAAATATTTAGTCACACATAAAATATTATTCATATTTTATCATCTAATAGCAATAAAAATACTAATTATA

Reverse complement sequence

TATAATTAGTATTTTTATTGCTATTAGATGATAAAATATGAATAATATTTTATGTGTGACTAAATATTTTCAAAATTTTCAAATAAGACATACGGTCAAA[C/T]
GTTGGACACGGATATCCACGGCTGCACTTATTTTGGGACGGAGGTAATATTATTTTACTAAGGGGAATCTTAGTTTTGAATCATATCCGGTCGTTTTCGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.90% 6.90% 0.36% 2.90% NA
All Indica  2759 83.00% 11.70% 0.47% 4.82% NA
All Japonica  1512 99.90% 0.00% 0.00% 0.07% NA
Aus  269 98.90% 0.00% 0.74% 0.37% NA
Indica I  595 66.10% 33.80% 0.17% 0.00% NA
Indica II  465 67.70% 7.30% 1.29% 23.66% NA
Indica III  913 99.30% 0.40% 0.11% 0.11% NA
Indica Intermediate  786 86.00% 10.60% 0.64% 2.80% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 94.40% 2.20% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0808474802 G -> A LOC_Os08g14195.1 upstream_gene_variant ; 4559.0bp to feature; MODIFIER silent_mutation Average:24.247; most accessible tissue: Callus, score: 54.385 N N N N
vg0808474802 G -> A LOC_Os08g14190.1 intron_variant ; MODIFIER silent_mutation Average:24.247; most accessible tissue: Callus, score: 54.385 N N N N
vg0808474802 G -> DEL N N silent_mutation Average:24.247; most accessible tissue: Callus, score: 54.385 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0808474802 NA 3.47E-06 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808474802 NA 1.55E-06 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808474802 NA 3.06E-07 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808474802 NA 1.25E-06 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808474802 NA 1.88E-06 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808474802 NA 3.98E-06 mr1125_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808474802 NA 3.34E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808474802 3.34E-06 3.34E-06 mr1615_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251