\
| Variant ID: vg0808474802 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 8474802 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 109. )
ACGAAAACGACCGGATATGATTCAAAACTAAGATTCCCCTTAGTAAAATAATATTACCTCCGTCCCAAAATAAGTGCAGCCGTGGATATCCGTGTCCAAC[G/A]
TTTGACCGTATGTCTTATTTGAAAATTTTGAAAATATTTAGTCACACATAAAATATTATTCATATTTTATCATCTAATAGCAATAAAAATACTAATTATA
TATAATTAGTATTTTTATTGCTATTAGATGATAAAATATGAATAATATTTTATGTGTGACTAAATATTTTCAAAATTTTCAAATAAGACATACGGTCAAA[C/T]
GTTGGACACGGATATCCACGGCTGCACTTATTTTGGGACGGAGGTAATATTATTTTACTAAGGGGAATCTTAGTTTTGAATCATATCCGGTCGTTTTCGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.90% | 6.90% | 0.36% | 2.90% | NA |
| All Indica | 2759 | 83.00% | 11.70% | 0.47% | 4.82% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.00% | 0.07% | NA |
| Aus | 269 | 98.90% | 0.00% | 0.74% | 0.37% | NA |
| Indica I | 595 | 66.10% | 33.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 67.70% | 7.30% | 1.29% | 23.66% | NA |
| Indica III | 913 | 99.30% | 0.40% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 86.00% | 10.60% | 0.64% | 2.80% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 94.40% | 2.20% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0808474802 | G -> A | LOC_Os08g14195.1 | upstream_gene_variant ; 4559.0bp to feature; MODIFIER | silent_mutation | Average:24.247; most accessible tissue: Callus, score: 54.385 | N | N | N | N |
| vg0808474802 | G -> A | LOC_Os08g14190.1 | intron_variant ; MODIFIER | silent_mutation | Average:24.247; most accessible tissue: Callus, score: 54.385 | N | N | N | N |
| vg0808474802 | G -> DEL | N | N | silent_mutation | Average:24.247; most accessible tissue: Callus, score: 54.385 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0808474802 | NA | 3.47E-06 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808474802 | NA | 1.55E-06 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808474802 | NA | 3.06E-07 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808474802 | NA | 1.25E-06 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808474802 | NA | 1.88E-06 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808474802 | NA | 3.98E-06 | mr1125_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808474802 | NA | 3.34E-06 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808474802 | 3.34E-06 | 3.34E-06 | mr1615_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |