\
| Variant ID: vg0808453559 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 8453559 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTGGAAGTTGTGGGAGAGACGCTACATCACTGGTCGAGGACCAGGCAGTAGCCGTAACTCGACCACTGAAAGTGGAAGTAGTCGGAGGAACGCTACATCG[C/T]
TGGTCGAGGACCAGGCAGTAGCCGTAACTCGACCACTGAAAGCAGAAGTGGTGGGAGAAAAGCTACGTCGCTAGTCGAGGACCAGGCAGTAGTCGTAACT
AGTTACGACTACTGCCTGGTCCTCGACTAGCGACGTAGCTTTTCTCCCACCACTTCTGCTTTCAGTGGTCGAGTTACGGCTACTGCCTGGTCCTCGACCA[G/A]
CGATGTAGCGTTCCTCCGACTACTTCCACTTTCAGTGGTCGAGTTACGGCTACTGCCTGGTCCTCGACCAGTGATGTAGCGTCTCTCCCACAACTTCCAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.40% | 16.90% | 1.48% | 1.18% | NA |
| All Indica | 2759 | 70.80% | 24.70% | 2.46% | 2.03% | NA |
| All Japonica | 1512 | 99.50% | 0.30% | 0.13% | 0.00% | NA |
| Aus | 269 | 64.70% | 35.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 69.60% | 17.80% | 5.38% | 7.23% | NA |
| Indica II | 465 | 88.20% | 5.40% | 6.24% | 0.22% | NA |
| Indica III | 913 | 59.50% | 40.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 74.60% | 23.00% | 0.89% | 1.53% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.40% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0808453559 | C -> T | LOC_Os08g14140.1 | upstream_gene_variant ; 1645.0bp to feature; MODIFIER | silent_mutation | Average:15.339; most accessible tissue: Callus, score: 45.456 | N | N | N | N |
| vg0808453559 | C -> T | LOC_Os08g14130.1 | downstream_gene_variant ; 3890.0bp to feature; MODIFIER | silent_mutation | Average:15.339; most accessible tissue: Callus, score: 45.456 | N | N | N | N |
| vg0808453559 | C -> T | LOC_Os08g14150.1 | downstream_gene_variant ; 1482.0bp to feature; MODIFIER | silent_mutation | Average:15.339; most accessible tissue: Callus, score: 45.456 | N | N | N | N |
| vg0808453559 | C -> T | LOC_Os08g14160.1 | downstream_gene_variant ; 2242.0bp to feature; MODIFIER | silent_mutation | Average:15.339; most accessible tissue: Callus, score: 45.456 | N | N | N | N |
| vg0808453559 | C -> T | LOC_Os08g14140-LOC_Os08g14150 | intergenic_region ; MODIFIER | silent_mutation | Average:15.339; most accessible tissue: Callus, score: 45.456 | N | N | N | N |
| vg0808453559 | C -> DEL | N | N | silent_mutation | Average:15.339; most accessible tissue: Callus, score: 45.456 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0808453559 | NA | 1.32E-07 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808453559 | NA | 2.15E-06 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808453559 | 8.25E-07 | 8.25E-07 | mr1374 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808453559 | NA | 8.41E-08 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808453559 | NA | 4.39E-06 | mr1510 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808453559 | 5.44E-06 | NA | mr1515 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808453559 | 8.78E-06 | 8.78E-06 | mr1687 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808453559 | 4.94E-06 | 8.85E-06 | mr1759 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808453559 | NA | 1.94E-06 | mr1844 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808453559 | 5.49E-06 | 5.49E-06 | mr1884 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |