\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808453559:

Variant ID: vg0808453559 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 8453559
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGGAAGTTGTGGGAGAGACGCTACATCACTGGTCGAGGACCAGGCAGTAGCCGTAACTCGACCACTGAAAGTGGAAGTAGTCGGAGGAACGCTACATCG[C/T]
TGGTCGAGGACCAGGCAGTAGCCGTAACTCGACCACTGAAAGCAGAAGTGGTGGGAGAAAAGCTACGTCGCTAGTCGAGGACCAGGCAGTAGTCGTAACT

Reverse complement sequence

AGTTACGACTACTGCCTGGTCCTCGACTAGCGACGTAGCTTTTCTCCCACCACTTCTGCTTTCAGTGGTCGAGTTACGGCTACTGCCTGGTCCTCGACCA[G/A]
CGATGTAGCGTTCCTCCGACTACTTCCACTTTCAGTGGTCGAGTTACGGCTACTGCCTGGTCCTCGACCAGTGATGTAGCGTCTCTCCCACAACTTCCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.40% 16.90% 1.48% 1.18% NA
All Indica  2759 70.80% 24.70% 2.46% 2.03% NA
All Japonica  1512 99.50% 0.30% 0.13% 0.00% NA
Aus  269 64.70% 35.30% 0.00% 0.00% NA
Indica I  595 69.60% 17.80% 5.38% 7.23% NA
Indica II  465 88.20% 5.40% 6.24% 0.22% NA
Indica III  913 59.50% 40.50% 0.00% 0.00% NA
Indica Intermediate  786 74.60% 23.00% 0.89% 1.53% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.40% 0.40% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0808453559 C -> T LOC_Os08g14140.1 upstream_gene_variant ; 1645.0bp to feature; MODIFIER silent_mutation Average:15.339; most accessible tissue: Callus, score: 45.456 N N N N
vg0808453559 C -> T LOC_Os08g14130.1 downstream_gene_variant ; 3890.0bp to feature; MODIFIER silent_mutation Average:15.339; most accessible tissue: Callus, score: 45.456 N N N N
vg0808453559 C -> T LOC_Os08g14150.1 downstream_gene_variant ; 1482.0bp to feature; MODIFIER silent_mutation Average:15.339; most accessible tissue: Callus, score: 45.456 N N N N
vg0808453559 C -> T LOC_Os08g14160.1 downstream_gene_variant ; 2242.0bp to feature; MODIFIER silent_mutation Average:15.339; most accessible tissue: Callus, score: 45.456 N N N N
vg0808453559 C -> T LOC_Os08g14140-LOC_Os08g14150 intergenic_region ; MODIFIER silent_mutation Average:15.339; most accessible tissue: Callus, score: 45.456 N N N N
vg0808453559 C -> DEL N N silent_mutation Average:15.339; most accessible tissue: Callus, score: 45.456 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0808453559 NA 1.32E-07 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808453559 NA 2.15E-06 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808453559 8.25E-07 8.25E-07 mr1374 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808453559 NA 8.41E-08 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808453559 NA 4.39E-06 mr1510 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808453559 5.44E-06 NA mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808453559 8.78E-06 8.78E-06 mr1687 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808453559 4.94E-06 8.85E-06 mr1759 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808453559 NA 1.94E-06 mr1844 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808453559 5.49E-06 5.49E-06 mr1884 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251