Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808447137:

Variant ID: vg0808447137 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 8447137
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

CTGGCATGCCGGGCCGCTCATAGGCCAAGCAGCGGCACGTAGACAAGCTAGACGTAGCGGAGAAGAATATTGCACGGACGGGGATACAAGTTTGTCTCGC[G/A]
GCGAGTTGCCCCCCTCCCCCCCCCCCCGGGATGATGAGATAGTGGTGCTTGAGGCCTTATGTGCAGCGAGCTTCGAGTCCACCATGGCTTCGTTGGTGGT

Reverse complement sequence

ACCACCAACGAAGCCATGGTGGACTCGAAGCTCGCTGCACATAAGGCCTCAAGCACCACTATCTCATCATCCCGGGGGGGGGGGGAGGGGGGCAACTCGC[C/T]
GCGAGACAAACTTGTATCCCCGTCCGTGCAATATTCTTCTCCGCTACGTCTAGCTTGTCTACGTGCCGCTGCTTGGCCTATGAGCGGCCCGGCATGCCAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.20%	30.30%	2.33%	1.14%	NA
All Indica	2759	51.00%	43.10%	3.95%	1.96%	NA
All Japonica	1512	90.30%	9.70%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	33.60%	58.00%	8.24%	0.17%	NA
Indica II	465	75.50%	20.60%	2.58%	1.29%	NA
Indica III	913	44.90%	49.30%	2.41%	3.40%	NA
Indica Intermediate	786	56.90%	37.80%	3.31%	2.04%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	81.00%	19.00%	0.00%	0.00%	NA
Japonica Intermediate	241	82.20%	17.80%	0.00%	0.00%	NA
VI/Aromatic	96	26.00%	74.00%	0.00%	0.00%	NA
Intermediate	90	71.10%	27.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0808447137	G -> A	LOC_Os08g14130.1	upstream_gene_variant ; 1497.0bp to feature; MODIFIER	silent_mutation	Average:66.208; most accessible tissue: Zhenshan97 flower, score: 91.386	N	N	N	N
vg0808447137	G -> A	LOC_Os08g14109.1	downstream_gene_variant ; 1218.0bp to feature; MODIFIER	silent_mutation	Average:66.208; most accessible tissue: Zhenshan97 flower, score: 91.386	N	N	N	N
vg0808447137	G -> A	LOC_Os08g14140.1	downstream_gene_variant ; 4523.0bp to feature; MODIFIER	silent_mutation	Average:66.208; most accessible tissue: Zhenshan97 flower, score: 91.386	N	N	N	N
vg0808447137	G -> A	LOC_Os08g14109-LOC_Os08g14130	intergenic_region ; MODIFIER	silent_mutation	Average:66.208; most accessible tissue: Zhenshan97 flower, score: 91.386	N	N	N	N
vg0808447137	G -> DEL	N	N	silent_mutation	Average:66.208; most accessible tissue: Zhenshan97 flower, score: 91.386	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0808447137	G	A	-0.02	-0.01	-0.01	-0.02	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0808447137	NA	7.65E-06	mr1092_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808447137	NA	2.22E-06	mr1097_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808447137	NA	3.90E-07	mr1152_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808447137	NA	1.11E-08	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808447137	NA	3.62E-06	mr1215_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808447137	NA	1.90E-08	mr1407_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808447137	6.84E-07	8.57E-08	mr1566_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808447137	NA	9.78E-08	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808447137	NA	2.22E-08	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808447137	NA	1.29E-06	mr1924_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808447137	NA	8.96E-06	mr1943_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251