\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808435872:

Variant ID: vg0808435872 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 8435872
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.08, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


AATCTTTCTCAGGCCTCCACGTTTTGCTCAACAAGGTCAACTACTATAAATTAAACATGATGTTGAATTCATAACCGCTGGGCTTGTGGACTGTCATAGA[C/T]
TGATGTAAACCTATATGCGTGGAAGGAATTCAGCCTCATAGAAAAGGGCACGTATTCTCAAGTTGAAATTTAAAATCTCCAAATTTCAAAGAGATGGTCC

Reverse complement sequence

GGACCATCTCTTTGAAATTTGGAGATTTTAAATTTCAACTTGAGAATACGTGCCCTTTTCTATGAGGCTGAATTCCTTCCACGCATATAGGTTTACATCA[G/A]
TCTATGACAGTCCACAAGCCCAGCGGTTATGAATTCAACATCATGTTTAATTTATAGTAGTTGACCTTGTTGAGCAAAACGTGGAGGCCTGAGAAAGATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.10% 0.80% 8.95% 9.18% NA
All Indica  2759 81.60% 0.60% 7.58% 10.29% NA
All Japonica  1512 90.80% 0.50% 5.56% 3.11% NA
Aus  269 39.80% 2.60% 24.54% 33.09% NA
Indica I  595 66.70% 0.70% 12.27% 20.34% NA
Indica II  465 78.90% 0.40% 10.11% 10.54% NA
Indica III  913 91.30% 0.50% 4.38% 3.72% NA
Indica Intermediate  786 83.00% 0.60% 6.23% 10.18% NA
Temperate Japonica  767 99.10% 0.00% 0.13% 0.78% NA
Tropical Japonica  504 82.30% 0.60% 11.51% 5.56% NA
Japonica Intermediate  241 82.20% 2.10% 10.37% 5.39% NA
VI/Aromatic  96 29.20% 2.10% 57.29% 11.46% NA
Intermediate  90 83.30% 3.30% 10.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0808435872 C -> T LOC_Os08g14109.1 upstream_gene_variant ; 1451.0bp to feature; MODIFIER silent_mutation Average:20.373; most accessible tissue: Minghui63 root, score: 38.567 N N N N
vg0808435872 C -> T LOC_Os08g14090.1 downstream_gene_variant ; 2477.0bp to feature; MODIFIER silent_mutation Average:20.373; most accessible tissue: Minghui63 root, score: 38.567 N N N N
vg0808435872 C -> T LOC_Os08g14090-LOC_Os08g14109 intergenic_region ; MODIFIER silent_mutation Average:20.373; most accessible tissue: Minghui63 root, score: 38.567 N N N N
vg0808435872 C -> DEL N N silent_mutation Average:20.373; most accessible tissue: Minghui63 root, score: 38.567 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0808435872 NA 1.27E-06 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808435872 NA 1.73E-06 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808435872 NA 2.77E-06 mr1376 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808435872 NA 1.05E-06 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808435872 NA 2.77E-06 mr1431 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808435872 NA 2.07E-06 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808435872 NA 3.91E-06 mr1807 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808435872 NA 2.17E-06 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808435872 NA 1.56E-07 mr1125_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808435872 NA 7.32E-07 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808435872 NA 8.02E-07 mr1553_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808435872 NA 1.26E-06 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251