\
| Variant ID: vg0808431807 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 8431807 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 232. )
TATTAATCAACATAAAGAAGAAGCACATTAATTTGTGCATTTATAATTATACTACTACATCTATCAGTGGTGTATCTTAAAAATAAAAAGAGCCCAAGTA[A/G]
ACTTATTTGCTATAAAAACTCTGTTTCAATCTTCTAATATATAATTTCAATGGATTCAGCAATGAGCCTGGGCAGCCGCCTGAGGTTGCTAGGGACAAAA
TTTTGTCCCTAGCAACCTCAGGCGGCTGCCCAGGCTCATTGCTGAATCCATTGAAATTATATATTAGAAGATTGAAACAGAGTTTTTATAGCAAATAAGT[T/C]
TACTTGGGCTCTTTTTATTTTTAAGATACACCACTGATAGATGTAGTAGTATAATTATAAATGCACAAATTAATGTGCTTCTTCTTTATGTTGATTAATA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.30% | 9.60% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 88.50% | 11.40% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 91.40% | 8.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.80% | 7.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.10% | 4.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 78.30% | 21.40% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 93.10% | 6.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 82.90% | 17.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 84.60% | 15.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0808431807 | A -> G | LOC_Os08g14090.1 | intron_variant ; MODIFIER | silent_mutation | Average:57.348; most accessible tissue: Callus, score: 66.995 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0808431807 | NA | 6.49E-07 | mr1397_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808431807 | 1.33E-06 | NA | mr1555_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808431807 | NA | 2.98E-06 | mr1600_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808431807 | NA | 5.84E-06 | mr1663_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808431807 | 3.73E-06 | 3.73E-06 | mr1674_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808431807 | 6.20E-06 | 6.19E-06 | mr1822_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808431807 | NA | 8.31E-06 | mr1843_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808431807 | NA | 6.16E-06 | mr1888_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808431807 | 4.01E-06 | 3.60E-06 | mr1982_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |