\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808428262:

Variant ID: vg0808428262 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 8428262
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCAATTACACAGTTTGCATGTAAATCGTGAGACGAATCTTTCGAGCCTAATTACGTCATGATTTGACAATGTGATGCTACAGTAAACATTTACTAATGAC[A/G]
GATTAATTATGCTTAATAGATTCGTCTCGCAGTTTACAGGAGGAATCTGTAATTTGTTTTGTTATTAGTCTACGTTTAATACTTCAAATATGTGCCCATA

Reverse complement sequence

TATGGGCACATATTTGAAGTATTAAACGTAGACTAATAACAAAACAAATTACAGATTCCTCCTGTAAACTGCGAGACGAATCTATTAAGCATAATTAATC[T/C]
GTCATTAGTAAATGTTTACTGTAGCATCACATTGTCAAATCATGACGTAATTAGGCTCGAAAGATTCGTCTCACGATTTACATGCAAACTGTGTAATTGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.20% 20.80% 2.22% 0.78% NA
All Indica  2759 92.30% 2.60% 3.73% 1.34% NA
All Japonica  1512 46.30% 53.60% 0.07% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 72.30% 2.80% 17.63% 7.31% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 93.30% 3.70% 2.67% 0.38% NA
Temperate Japonica  767 28.40% 71.60% 0.00% 0.00% NA
Tropical Japonica  504 81.00% 19.00% 0.00% 0.00% NA
Japonica Intermediate  241 30.70% 68.90% 0.41% 0.00% NA
VI/Aromatic  96 26.00% 74.00% 0.00% 0.00% NA
Intermediate  90 76.70% 22.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0808428262 A -> G LOC_Os08g14090.1 upstream_gene_variant ; 2840.0bp to feature; MODIFIER silent_mutation Average:27.636; most accessible tissue: Zhenshan97 flower, score: 45.068 N N N N
vg0808428262 A -> G LOC_Os08g14070.1 downstream_gene_variant ; 2971.0bp to feature; MODIFIER silent_mutation Average:27.636; most accessible tissue: Zhenshan97 flower, score: 45.068 N N N N
vg0808428262 A -> G LOC_Os08g14070-LOC_Os08g14090 intergenic_region ; MODIFIER silent_mutation Average:27.636; most accessible tissue: Zhenshan97 flower, score: 45.068 N N N N
vg0808428262 A -> DEL N N silent_mutation Average:27.636; most accessible tissue: Zhenshan97 flower, score: 45.068 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0808428262 NA 8.23E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808428262 NA 1.20E-07 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808428262 NA 2.64E-08 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808428262 9.46E-07 5.78E-09 mr1718 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808428262 NA 3.87E-08 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808428262 NA 3.41E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808428262 NA 2.48E-10 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808428262 NA 4.62E-09 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808428262 NA 3.19E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808428262 NA 1.20E-08 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808428262 NA 5.09E-09 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251