Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808428262:

Variant ID: vg0808428262 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 8428262
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCAATTACACAGTTTGCATGTAAATCGTGAGACGAATCTTTCGAGCCTAATTACGTCATGATTTGACAATGTGATGCTACAGTAAACATTTACTAATGAC[A/G]
GATTAATTATGCTTAATAGATTCGTCTCGCAGTTTACAGGAGGAATCTGTAATTTGTTTTGTTATTAGTCTACGTTTAATACTTCAAATATGTGCCCATA

Reverse complement sequence

TATGGGCACATATTTGAAGTATTAAACGTAGACTAATAACAAAACAAATTACAGATTCCTCCTGTAAACTGCGAGACGAATCTATTAAGCATAATTAATC[T/C]
GTCATTAGTAAATGTTTACTGTAGCATCACATTGTCAAATCATGACGTAATTAGGCTCGAAAGATTCGTCTCACGATTTACATGCAAACTGTGTAATTGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.20%	20.80%	2.22%	0.78%	NA
All Indica	2759	92.30%	2.60%	3.73%	1.34%	NA
All Japonica	1512	46.30%	53.60%	0.07%	0.00%	NA
Aus	269	97.80%	2.20%	0.00%	0.00%	NA
Indica I	595	96.10%	3.90%	0.00%	0.00%	NA
Indica II	465	72.30%	2.80%	17.63%	7.31%	NA
Indica III	913	99.10%	0.90%	0.00%	0.00%	NA
Indica Intermediate	786	93.30%	3.70%	2.67%	0.38%	NA
Temperate Japonica	767	28.40%	71.60%	0.00%	0.00%	NA
Tropical Japonica	504	81.00%	19.00%	0.00%	0.00%	NA
Japonica Intermediate	241	30.70%	68.90%	0.41%	0.00%	NA
VI/Aromatic	96	26.00%	74.00%	0.00%	0.00%	NA
Intermediate	90	76.70%	22.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0808428262	A -> G	LOC_Os08g14090.1	upstream_gene_variant ; 2840.0bp to feature; MODIFIER	silent_mutation	Average:27.636; most accessible tissue: Zhenshan97 flower, score: 45.068	N	N	N	N
vg0808428262	A -> G	LOC_Os08g14070.1	downstream_gene_variant ; 2971.0bp to feature; MODIFIER	silent_mutation	Average:27.636; most accessible tissue: Zhenshan97 flower, score: 45.068	N	N	N	N
vg0808428262	A -> G	LOC_Os08g14070-LOC_Os08g14090	intergenic_region ; MODIFIER	silent_mutation	Average:27.636; most accessible tissue: Zhenshan97 flower, score: 45.068	N	N	N	N
vg0808428262	A -> DEL	N	N	silent_mutation	Average:27.636; most accessible tissue: Zhenshan97 flower, score: 45.068	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0808428262	NA	8.23E-08	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808428262	NA	1.20E-07	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808428262	NA	2.64E-08	mr1334	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808428262	9.46E-07	5.78E-09	mr1718	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808428262	NA	3.87E-08	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808428262	NA	3.41E-07	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808428262	NA	2.48E-10	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808428262	NA	4.62E-09	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808428262	NA	3.19E-06	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808428262	NA	1.20E-08	mr1471_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808428262	NA	5.09E-09	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251