\
| Variant ID: vg0808428262 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 8428262 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCAATTACACAGTTTGCATGTAAATCGTGAGACGAATCTTTCGAGCCTAATTACGTCATGATTTGACAATGTGATGCTACAGTAAACATTTACTAATGAC[A/G]
GATTAATTATGCTTAATAGATTCGTCTCGCAGTTTACAGGAGGAATCTGTAATTTGTTTTGTTATTAGTCTACGTTTAATACTTCAAATATGTGCCCATA
TATGGGCACATATTTGAAGTATTAAACGTAGACTAATAACAAAACAAATTACAGATTCCTCCTGTAAACTGCGAGACGAATCTATTAAGCATAATTAATC[T/C]
GTCATTAGTAAATGTTTACTGTAGCATCACATTGTCAAATCATGACGTAATTAGGCTCGAAAGATTCGTCTCACGATTTACATGCAAACTGTGTAATTGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.20% | 20.80% | 2.22% | 0.78% | NA |
| All Indica | 2759 | 92.30% | 2.60% | 3.73% | 1.34% | NA |
| All Japonica | 1512 | 46.30% | 53.60% | 0.07% | 0.00% | NA |
| Aus | 269 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 72.30% | 2.80% | 17.63% | 7.31% | NA |
| Indica III | 913 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.30% | 3.70% | 2.67% | 0.38% | NA |
| Temperate Japonica | 767 | 28.40% | 71.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 81.00% | 19.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 30.70% | 68.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 26.00% | 74.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 22.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0808428262 | A -> G | LOC_Os08g14090.1 | upstream_gene_variant ; 2840.0bp to feature; MODIFIER | silent_mutation | Average:27.636; most accessible tissue: Zhenshan97 flower, score: 45.068 | N | N | N | N |
| vg0808428262 | A -> G | LOC_Os08g14070.1 | downstream_gene_variant ; 2971.0bp to feature; MODIFIER | silent_mutation | Average:27.636; most accessible tissue: Zhenshan97 flower, score: 45.068 | N | N | N | N |
| vg0808428262 | A -> G | LOC_Os08g14070-LOC_Os08g14090 | intergenic_region ; MODIFIER | silent_mutation | Average:27.636; most accessible tissue: Zhenshan97 flower, score: 45.068 | N | N | N | N |
| vg0808428262 | A -> DEL | N | N | silent_mutation | Average:27.636; most accessible tissue: Zhenshan97 flower, score: 45.068 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0808428262 | NA | 8.23E-08 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428262 | NA | 1.20E-07 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428262 | NA | 2.64E-08 | mr1334 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428262 | 9.46E-07 | 5.78E-09 | mr1718 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428262 | NA | 3.87E-08 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428262 | NA | 3.41E-07 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428262 | NA | 2.48E-10 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428262 | NA | 4.62E-09 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428262 | NA | 3.19E-06 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428262 | NA | 1.20E-08 | mr1471_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428262 | NA | 5.09E-09 | mr1568_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |