\
| Variant ID: vg0808428148 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 8428148 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTTAAAATTTAGGTCCGTGTTTAGATTCAAACTTTTTTCTTCAAACTTTCAATTTTTTCCGTCACATTAAATGTTTGGATACATGTATGGAGCATTAAAT[G/A]
TGGACGAAAAAAACCAATTACACAGTTTGCATGTAAATCGTGAGACGAATCTTTCGAGCCTAATTACGTCATGATTTGACAATGTGATGCTACAGTAAAC
GTTTACTGTAGCATCACATTGTCAAATCATGACGTAATTAGGCTCGAAAGATTCGTCTCACGATTTACATGCAAACTGTGTAATTGGTTTTTTTCGTCCA[C/T]
ATTTAATGCTCCATACATGTATCCAAACATTTAATGTGACGGAAAAAATTGAAAGTTTGAAGAAAAAAGTTTGAATCTAAACACGGACCTAAATTTTAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.00% | 9.60% | 7.93% | 16.53% | NA |
| All Indica | 2759 | 51.80% | 11.40% | 12.21% | 24.61% | NA |
| All Japonica | 1512 | 89.60% | 8.40% | 1.79% | 0.20% | NA |
| Aus | 269 | 66.20% | 0.00% | 2.60% | 31.23% | NA |
| Indica I | 595 | 66.70% | 7.10% | 6.55% | 19.66% | NA |
| Indica II | 465 | 74.60% | 4.90% | 7.31% | 13.12% | NA |
| Indica III | 913 | 23.80% | 21.50% | 18.29% | 36.47% | NA |
| Indica Intermediate | 786 | 59.40% | 6.90% | 12.34% | 21.37% | NA |
| Temperate Japonica | 767 | 98.70% | 0.90% | 0.13% | 0.26% | NA |
| Tropical Japonica | 504 | 79.60% | 16.90% | 3.37% | 0.20% | NA |
| Japonica Intermediate | 241 | 81.70% | 14.50% | 3.73% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 0.00% | 1.04% | 5.21% | NA |
| Intermediate | 90 | 74.40% | 11.10% | 3.33% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0808428148 | G -> A | LOC_Os08g14090.1 | upstream_gene_variant ; 2954.0bp to feature; MODIFIER | silent_mutation | Average:44.719; most accessible tissue: Zhenshan97 flower, score: 83.915 | N | N | N | N |
| vg0808428148 | G -> A | LOC_Os08g14070.1 | downstream_gene_variant ; 2857.0bp to feature; MODIFIER | silent_mutation | Average:44.719; most accessible tissue: Zhenshan97 flower, score: 83.915 | N | N | N | N |
| vg0808428148 | G -> A | LOC_Os08g14070-LOC_Os08g14090 | intergenic_region ; MODIFIER | silent_mutation | Average:44.719; most accessible tissue: Zhenshan97 flower, score: 83.915 | N | N | N | N |
| vg0808428148 | G -> DEL | N | N | silent_mutation | Average:44.719; most accessible tissue: Zhenshan97 flower, score: 83.915 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0808428148 | 4.14E-06 | NA | mr1050_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428148 | 1.54E-06 | 1.54E-06 | mr1192_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428148 | 6.51E-06 | 2.23E-06 | mr1267_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428148 | 7.19E-07 | 2.54E-07 | mr1312_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428148 | 1.31E-06 | 1.31E-06 | mr1312_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428148 | 6.84E-06 | 3.62E-06 | mr1373_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428148 | 1.41E-06 | 1.41E-06 | mr1373_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428148 | 8.54E-07 | 6.37E-08 | mr1397_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428148 | NA | 4.03E-06 | mr1397_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428148 | 1.17E-06 | 1.17E-06 | mr1634_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428148 | 2.68E-06 | 2.68E-06 | mr1634_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428148 | NA | 4.63E-06 | mr1652_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428148 | 1.60E-07 | 1.29E-07 | mr1663_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428148 | 1.91E-06 | 1.91E-06 | mr1663_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428148 | NA | 4.89E-06 | mr1666_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428148 | 1.54E-07 | 1.54E-07 | mr1674_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428148 | 2.94E-07 | 2.94E-07 | mr1688_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428148 | 7.99E-06 | 7.99E-06 | mr1697_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428148 | NA | 6.68E-06 | mr1738_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428148 | 4.34E-07 | 4.35E-07 | mr1822_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428148 | 5.60E-06 | 1.92E-06 | mr1843_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428148 | 2.63E-06 | 2.63E-06 | mr1847_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428148 | 5.47E-06 | NA | mr1888_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428148 | 9.71E-06 | NA | mr1980_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808428148 | 9.67E-07 | 8.00E-07 | mr1982_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |