\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808371714:

Variant ID: vg0808371714 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 8371714
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCATAACCTTTACCAATAAAATATTCATGTTTAGACACGACCACTTTATTAGACTCAAAAACCAACTTAAATCCGTCTCTAGTCAGACGGGAGCCACTA[G/A]
CAAGATTCCTGTCGATAGTAGGGACATACTGCACGTTCTTCAGCTGCACAATCTTCCCCGAAGTAAACTTTAGATCTGCCGTGCCAACACCATGAACAGA

Reverse complement sequence

TCTGTTCATGGTGTTGGCACGGCAGATCTAAAGTTTACTTCGGGGAAGATTGTGCAGCTGAAGAACGTGCAGTATGTCCCTACTATCGACAGGAATCTTG[C/T]
TAGTGGCTCCCGTCTGACTAGAGACGGATTTAAGTTGGTTTTTGAGTCTAATAAAGTGGTCGTGTCTAAACATGAATATTTTATTGGTAAAGGTTATGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.70% 0.30% 2.14% 51.84% NA
All Indica  2759 25.60% 0.30% 2.57% 71.58% NA
All Japonica  1512 90.70% 0.00% 0.53% 8.80% NA
Aus  269 8.60% 1.90% 7.81% 81.78% NA
Indica I  595 23.20% 0.20% 3.19% 73.45% NA
Indica II  465 63.20% 0.00% 1.51% 35.27% NA
Indica III  913 2.80% 0.80% 2.19% 94.19% NA
Indica Intermediate  786 31.40% 0.00% 3.18% 65.39% NA
Temperate Japonica  767 98.70% 0.00% 0.00% 1.30% NA
Tropical Japonica  504 84.10% 0.00% 0.99% 14.88% NA
Japonica Intermediate  241 78.80% 0.00% 1.24% 19.92% NA
VI/Aromatic  96 11.50% 0.00% 1.04% 87.50% NA
Intermediate  90 57.80% 0.00% 0.00% 42.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0808371714 G -> A LOC_Os08g13970.1 downstream_gene_variant ; 3933.0bp to feature; MODIFIER silent_mutation Average:20.306; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0808371714 G -> A LOC_Os08g13960.1 intron_variant ; MODIFIER silent_mutation Average:20.306; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0808371714 G -> DEL N N silent_mutation Average:20.306; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0808371714 NA 2.24E-07 mr1380_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808371714 NA 3.59E-06 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808371714 7.99E-06 9.21E-08 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808371714 NA 5.46E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808371714 NA 9.78E-07 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808371714 NA 8.95E-08 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808371714 NA 4.14E-07 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251