\
| Variant ID: vg0808371714 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 8371714 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTCATAACCTTTACCAATAAAATATTCATGTTTAGACACGACCACTTTATTAGACTCAAAAACCAACTTAAATCCGTCTCTAGTCAGACGGGAGCCACTA[G/A]
CAAGATTCCTGTCGATAGTAGGGACATACTGCACGTTCTTCAGCTGCACAATCTTCCCCGAAGTAAACTTTAGATCTGCCGTGCCAACACCATGAACAGA
TCTGTTCATGGTGTTGGCACGGCAGATCTAAAGTTTACTTCGGGGAAGATTGTGCAGCTGAAGAACGTGCAGTATGTCCCTACTATCGACAGGAATCTTG[C/T]
TAGTGGCTCCCGTCTGACTAGAGACGGATTTAAGTTGGTTTTTGAGTCTAATAAAGTGGTCGTGTCTAAACATGAATATTTTATTGGTAAAGGTTATGAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.70% | 0.30% | 2.14% | 51.84% | NA |
| All Indica | 2759 | 25.60% | 0.30% | 2.57% | 71.58% | NA |
| All Japonica | 1512 | 90.70% | 0.00% | 0.53% | 8.80% | NA |
| Aus | 269 | 8.60% | 1.90% | 7.81% | 81.78% | NA |
| Indica I | 595 | 23.20% | 0.20% | 3.19% | 73.45% | NA |
| Indica II | 465 | 63.20% | 0.00% | 1.51% | 35.27% | NA |
| Indica III | 913 | 2.80% | 0.80% | 2.19% | 94.19% | NA |
| Indica Intermediate | 786 | 31.40% | 0.00% | 3.18% | 65.39% | NA |
| Temperate Japonica | 767 | 98.70% | 0.00% | 0.00% | 1.30% | NA |
| Tropical Japonica | 504 | 84.10% | 0.00% | 0.99% | 14.88% | NA |
| Japonica Intermediate | 241 | 78.80% | 0.00% | 1.24% | 19.92% | NA |
| VI/Aromatic | 96 | 11.50% | 0.00% | 1.04% | 87.50% | NA |
| Intermediate | 90 | 57.80% | 0.00% | 0.00% | 42.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0808371714 | G -> A | LOC_Os08g13970.1 | downstream_gene_variant ; 3933.0bp to feature; MODIFIER | silent_mutation | Average:20.306; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0808371714 | G -> A | LOC_Os08g13960.1 | intron_variant ; MODIFIER | silent_mutation | Average:20.306; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0808371714 | G -> DEL | N | N | silent_mutation | Average:20.306; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0808371714 | NA | 2.24E-07 | mr1380_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808371714 | NA | 3.59E-06 | mr1522_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808371714 | 7.99E-06 | 9.21E-08 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808371714 | NA | 5.46E-06 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808371714 | NA | 9.78E-07 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808371714 | NA | 8.95E-08 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808371714 | NA | 4.14E-07 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |