\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808332749:

Variant ID: vg0808332749 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 8332749
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TCTCCATGCAACACACGCGAAATCAATATAGGGTTTGCCTCTTCCTCTGTATTGCACCGTCACTCGTAGTCTACTCCATCCCGCTCGTCGGCATGCACCG[G/A]
CGATCGGGAGAGTAGATCTCCGGAACCTTCACCTTCGATGTCCTGCATTGGGAGAAGGCGGCAATAAGGTTTTTGGGAAGCGCTTTGCGCGACCGCTCTC

Reverse complement sequence

GAGAGCGGTCGCGCAAAGCGCTTCCCAAAAACCTTATTGCCGCCTTCTCCCAATGCAGGACATCGAAGGTGAAGGTTCCGGAGATCTACTCTCCCGATCG[C/T]
CGGTGCATGCCGACGAGCGGGATGGAGTAGACTACGAGTGACGGTGCAATACAGAGGAAGAGGCAAACCCTATATTGATTTCGCGTGTGTTGCATGGAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.80% 37.20% 0.06% 0.00% NA
All Indica  2759 41.60% 58.20% 0.11% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 62.50% 37.50% 0.00% 0.00% NA
Indica I  595 50.90% 49.10% 0.00% 0.00% NA
Indica II  465 80.60% 19.40% 0.00% 0.00% NA
Indica III  913 14.70% 85.10% 0.22% 0.00% NA
Indica Intermediate  786 42.90% 57.00% 0.13% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0808332749 G -> A LOC_Os08g13920.1 downstream_gene_variant ; 3350.0bp to feature; MODIFIER silent_mutation Average:72.862; most accessible tissue: Minghui63 flag leaf, score: 79.383 N N N N
vg0808332749 G -> A LOC_Os08g13920-LOC_Os08g13930 intergenic_region ; MODIFIER silent_mutation Average:72.862; most accessible tissue: Minghui63 flag leaf, score: 79.383 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0808332749 NA 7.39E-07 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808332749 NA 6.09E-08 mr1175_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808332749 NA 7.21E-07 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808332749 NA 2.30E-07 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808332749 NA 2.65E-09 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808332749 NA 7.59E-08 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808332749 NA 9.28E-07 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808332749 NA 2.87E-07 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808332749 NA 7.59E-08 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808332749 NA 1.26E-06 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808332749 NA 8.22E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808332749 NA 5.50E-06 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808332749 NA 7.89E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808332749 NA 1.13E-07 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808332749 NA 8.08E-06 mr1994_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808332749 NA 1.06E-06 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808332749 NA 1.39E-08 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251