\
| Variant ID: vg0808279687 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 8279687 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.62, C: 0.37, others allele: 0.00, population size: 76. )
AGTGGATGACTCGGCGAGGAAGCTGTGGGCGGTGATGGCAGGGACGGCAGTAGGTAGAGTGTAGAGGTCCCCACGACTATTGCAACGAAGAATCACGCGC[T/C]
GGGTTTGAAGGTCCTTCACAAAGAAACCAAACTCGTCAAATTCAATTGAGCATTTGTTGTCGCGGGTAAATTGACGAACAGAAAGTAAGTTTCGAACCAA
TTGGTTCGAAACTTACTTTCTGTTCGTCAATTTACCCGCGACAACAAATGCTCAATTGAATTTGACGAGTTTGGTTTCTTTGTGAAGGACCTTCAAACCC[A/G]
GCGCGTGATTCTTCGTTGCAATAGTCGTGGGGACCTCTACACTCTACCTACTGCCGTCCCTGCCATCACCGCCCACAGCTTCCTCGCCGAGTCATCCACT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.70% | 4.30% | 1.86% | 64.09% | NA |
| All Indica | 2759 | 5.00% | 0.40% | 1.49% | 93.04% | NA |
| All Japonica | 1512 | 81.60% | 7.40% | 0.00% | 10.98% | NA |
| Aus | 269 | 0.70% | 2.20% | 15.99% | 81.04% | NA |
| Indica I | 595 | 8.20% | 0.00% | 1.85% | 89.92% | NA |
| Indica II | 465 | 6.00% | 0.20% | 1.29% | 92.47% | NA |
| Indica III | 913 | 1.80% | 0.90% | 0.99% | 96.39% | NA |
| Indica Intermediate | 786 | 5.90% | 0.40% | 1.91% | 91.86% | NA |
| Temperate Japonica | 767 | 93.50% | 4.00% | 0.00% | 2.48% | NA |
| Tropical Japonica | 504 | 75.40% | 3.00% | 0.00% | 21.63% | NA |
| Japonica Intermediate | 241 | 56.80% | 27.40% | 0.00% | 15.77% | NA |
| VI/Aromatic | 96 | 2.10% | 72.90% | 0.00% | 25.00% | NA |
| Intermediate | 90 | 30.00% | 5.60% | 4.44% | 60.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0808279687 | T -> C | LOC_Os08g13870.1 | downstream_gene_variant ; 3275.0bp to feature; MODIFIER | silent_mutation | Average:9.872; most accessible tissue: Callus, score: 34.609 | N | N | N | N |
| vg0808279687 | T -> C | LOC_Os08g13860.1 | intron_variant ; MODIFIER | silent_mutation | Average:9.872; most accessible tissue: Callus, score: 34.609 | N | N | N | N |
| vg0808279687 | T -> DEL | N | N | silent_mutation | Average:9.872; most accessible tissue: Callus, score: 34.609 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0808279687 | NA | 1.01E-13 | mr1641 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808279687 | NA | 5.25E-15 | mr1909 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808279687 | NA | 3.94E-12 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808279687 | NA | 4.74E-24 | mr1024_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808279687 | NA | 3.30E-09 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808279687 | NA | 1.75E-12 | mr1258_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808279687 | NA | 3.97E-07 | mr1334_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808279687 | NA | 2.59E-14 | mr1529_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808279687 | NA | 1.13E-11 | mr1641_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808279687 | NA | 2.52E-12 | mr1714_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808279687 | NA | 7.83E-15 | mr1767_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808279687 | NA | 4.00E-09 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808279687 | NA | 3.36E-08 | mr1921_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808279687 | NA | 1.03E-24 | mr1968_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808279687 | 1.37E-06 | 1.01E-07 | mr1987_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |