Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0808255183:

Variant ID: vg0808255183 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 8255183
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


AGCAATATAAGAGTTGACTAATATCTGCCCCAGCTTGATTGTCACCAAAGACACCGTTGATGCCTTCTTCTTCTTTTGTACTATTGTACAAGAACAGAAA[G/T]
ATATTTTTATGAGTGTTCACACTGTTAGCTGGTGAGATGTGTTAAAAAAAAAACTAAAGCTTCTTAATATTTGAATATATATTAGCTGTTCTTTTAAGGT

Reverse complement sequence

ACCTTAAAAGAACAGCTAATATATATTCAAATATTAAGAAGCTTTAGTTTTTTTTTTAACACATCTCACCAGCTAACAGTGTGAACACTCATAAAAATAT[C/A]
TTTCTGTTCTTGTACAATAGTACAAAAGAAGAAGAAGGCATCAACGGTGTCTTTGGTGACAATCAAGCTGGGGCAGATATTAGTCAACTCTTATATTGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.50% 5.50% 0.00% 0.00% NA
All Indica  2759 99.50% 0.50% 0.00% 0.00% NA
All Japonica  1512 93.20% 6.80% 0.00% 0.00% NA
Aus  269 52.40% 47.60% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 98.50% 1.50% 0.00% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 83.90% 16.10% 0.00% 0.00% NA
Japonica Intermediate  241 92.90% 7.10% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0808255183 G -> T LOC_Os08g13820.1 upstream_gene_variant ; 4660.0bp to feature; MODIFIER silent_mutation Average:71.693; most accessible tissue: Minghui63 root, score: 97.248 N N N N
vg0808255183 G -> T LOC_Os08g13830.1 downstream_gene_variant ; 3076.0bp to feature; MODIFIER silent_mutation Average:71.693; most accessible tissue: Minghui63 root, score: 97.248 N N N N
vg0808255183 G -> T LOC_Os08g13840.1 downstream_gene_variant ; 3271.0bp to feature; MODIFIER silent_mutation Average:71.693; most accessible tissue: Minghui63 root, score: 97.248 N N N N
vg0808255183 G -> T LOC_Os08g13840.2 downstream_gene_variant ; 3392.0bp to feature; MODIFIER silent_mutation Average:71.693; most accessible tissue: Minghui63 root, score: 97.248 N N N N
vg0808255183 G -> T LOC_Os08g13830-LOC_Os08g13840 intergenic_region ; MODIFIER silent_mutation Average:71.693; most accessible tissue: Minghui63 root, score: 97.248 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0808255183 G T 0.03 0.02 0.0 0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0808255183 NA 4.88E-07 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808255183 NA 8.42E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808255183 NA 7.32E-07 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808255183 NA 2.93E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808255183 NA 1.62E-07 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808255183 NA 4.02E-07 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808255183 NA 7.82E-07 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808255183 NA 1.80E-06 mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808255183 NA 9.90E-06 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808255183 NA 5.23E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808255183 NA 3.48E-09 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808255183 1.43E-07 4.22E-30 mr1757_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808255183 NA 1.36E-06 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251