Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808243581:

Variant ID: vg0808243581 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 8243581
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGAGAGGATCGACTTTGTCATTGCACGGGCACAGTACTATGCGAGCTCGACCGGATTATCGGATTTGATGGGAAGATCGGCTCCGTCATGGTACGGGCAC[A/G]
AGACTGTTCGAGCTGGGCCTACAGCTCCACTTGTGGGCTGAGCCGAAGAGAGGTAGGCCGAGCAAATAGAGGTAGCATACTAGGCTAGGACTAGAGCTGA

Reverse complement sequence

TCAGCTCTAGTCCTAGCCTAGTATGCTACCTCTATTTGCTCGGCCTACCTCTCTTCGGCTCAGCCCACAAGTGGAGCTGTAGGCCCAGCTCGAACAGTCT[T/C]
GTGCCCGTACCATGACGGAGCCGATCTTCCCATCAAATCCGATAATCCGGTCGAGCTCGCATAGTACTGTGCCCGTGCAATGACAAAGTCGATCCTCTCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.70%	36.00%	0.13%	2.18%	NA
All Indica	2759	95.60%	4.20%	0.11%	0.07%	NA
All Japonica	1512	4.30%	89.00%	0.13%	6.61%	NA
Aus	269	53.50%	46.50%	0.00%	0.00%	NA
Indica I	595	94.10%	5.70%	0.17%	0.00%	NA
Indica II	465	96.10%	3.40%	0.43%	0.00%	NA
Indica III	913	98.10%	1.90%	0.00%	0.00%	NA
Indica Intermediate	786	93.40%	6.40%	0.00%	0.25%	NA
Temperate Japonica	767	2.00%	94.70%	0.00%	3.39%	NA
Tropical Japonica	504	5.60%	91.50%	0.00%	2.98%	NA
Japonica Intermediate	241	9.10%	65.60%	0.83%	24.48%	NA
VI/Aromatic	96	20.80%	79.20%	0.00%	0.00%	NA
Intermediate	90	55.60%	42.20%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0808243581	A -> G	LOC_Os08g13810.1	upstream_gene_variant ; 170.0bp to feature; MODIFIER	silent_mutation	Average:44.73; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0808243581	A -> G	LOC_Os08g13800-LOC_Os08g13810	intergenic_region ; MODIFIER	silent_mutation	Average:44.73; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0808243581	A -> DEL	N	N	silent_mutation	Average:44.73; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0808243581	NA	6.19E-09	mr1006	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808243581	NA	2.54E-08	mr1007	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808243581	NA	9.06E-06	mr1011	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808243581	NA	5.67E-09	mr1052	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808243581	NA	1.65E-26	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808243581	NA	8.20E-14	mr1376	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808243581	NA	9.34E-07	mr1415	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808243581	NA	8.20E-14	mr1431	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808243581	NA	9.34E-07	mr1567	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808243581	NA	3.43E-07	mr1587	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808243581	NA	6.93E-06	mr1806	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808243581	NA	1.21E-15	mr1842	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808243581	NA	7.03E-08	mr1219_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808243581	NA	4.91E-08	mr1334_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251