\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808243581:

Variant ID: vg0808243581 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 8243581
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAGAGGATCGACTTTGTCATTGCACGGGCACAGTACTATGCGAGCTCGACCGGATTATCGGATTTGATGGGAAGATCGGCTCCGTCATGGTACGGGCAC[A/G]
AGACTGTTCGAGCTGGGCCTACAGCTCCACTTGTGGGCTGAGCCGAAGAGAGGTAGGCCGAGCAAATAGAGGTAGCATACTAGGCTAGGACTAGAGCTGA

Reverse complement sequence

TCAGCTCTAGTCCTAGCCTAGTATGCTACCTCTATTTGCTCGGCCTACCTCTCTTCGGCTCAGCCCACAAGTGGAGCTGTAGGCCCAGCTCGAACAGTCT[T/C]
GTGCCCGTACCATGACGGAGCCGATCTTCCCATCAAATCCGATAATCCGGTCGAGCTCGCATAGTACTGTGCCCGTGCAATGACAAAGTCGATCCTCTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.70% 36.00% 0.13% 2.18% NA
All Indica  2759 95.60% 4.20% 0.11% 0.07% NA
All Japonica  1512 4.30% 89.00% 0.13% 6.61% NA
Aus  269 53.50% 46.50% 0.00% 0.00% NA
Indica I  595 94.10% 5.70% 0.17% 0.00% NA
Indica II  465 96.10% 3.40% 0.43% 0.00% NA
Indica III  913 98.10% 1.90% 0.00% 0.00% NA
Indica Intermediate  786 93.40% 6.40% 0.00% 0.25% NA
Temperate Japonica  767 2.00% 94.70% 0.00% 3.39% NA
Tropical Japonica  504 5.60% 91.50% 0.00% 2.98% NA
Japonica Intermediate  241 9.10% 65.60% 0.83% 24.48% NA
VI/Aromatic  96 20.80% 79.20% 0.00% 0.00% NA
Intermediate  90 55.60% 42.20% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0808243581 A -> G LOC_Os08g13810.1 upstream_gene_variant ; 170.0bp to feature; MODIFIER silent_mutation Average:44.73; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0808243581 A -> G LOC_Os08g13800-LOC_Os08g13810 intergenic_region ; MODIFIER silent_mutation Average:44.73; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0808243581 A -> DEL N N silent_mutation Average:44.73; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0808243581 NA 6.19E-09 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808243581 NA 2.54E-08 mr1007 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808243581 NA 9.06E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808243581 NA 5.67E-09 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808243581 NA 1.65E-26 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808243581 NA 8.20E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808243581 NA 9.34E-07 mr1415 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808243581 NA 8.20E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808243581 NA 9.34E-07 mr1567 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808243581 NA 3.43E-07 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808243581 NA 6.93E-06 mr1806 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808243581 NA 1.21E-15 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808243581 NA 7.03E-08 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808243581 NA 4.91E-08 mr1334_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251