\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808213475:

Variant ID: vg0808213475 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 8213475
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCAGGTAGTTGGATTAGCCATGATCGAACGACACCTGATCGAGAGAGGTCGGCAGATAATTCACTATTATTGCCCGCTCATTAATTCCCTCCTGCGCCC[A/G]
GCTAGTCCCCTTAAGTTATCTGTGCTACCGAGGCTGGCTAGAAAAACAGTATTTTGAAAGAAGATAATTCACTCCGGCCGGCTTAATAACAATATTTTAG

Reverse complement sequence

CTAAAATATTGTTATTAAGCCGGCCGGAGTGAATTATCTTCTTTCAAAATACTGTTTTTCTAGCCAGCCTCGGTAGCACAGATAACTTAAGGGGACTAGC[T/C]
GGGCGCAGGAGGGAATTAATGAGCGGGCAATAATAGTGAATTATCTGCCGACCTCTCTCGATCAGGTGTCGTTCGATCATGGCTAATCCAACTACCTGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.00% 28.30% 12.25% 16.46% NA
All Indica  2759 53.10% 2.90% 20.22% 23.74% NA
All Japonica  1512 10.90% 81.50% 0.33% 7.21% NA
Aus  269 98.90% 0.40% 0.37% 0.37% NA
Indica I  595 34.50% 5.50% 37.82% 22.18% NA
Indica II  465 66.90% 2.80% 15.05% 15.27% NA
Indica III  913 60.80% 0.30% 8.87% 30.01% NA
Indica Intermediate  786 50.10% 4.10% 23.16% 22.65% NA
Temperate Japonica  767 2.20% 93.60% 0.39% 3.78% NA
Tropical Japonica  504 21.20% 75.20% 0.20% 3.37% NA
Japonica Intermediate  241 17.00% 56.40% 0.41% 26.14% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 43.30% 26.70% 16.67% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0808213475 A -> G LOC_Os08g13770.1 upstream_gene_variant ; 3504.0bp to feature; MODIFIER silent_mutation Average:59.152; most accessible tissue: Callus, score: 91.854 N N N N
vg0808213475 A -> G LOC_Os08g13780.1 upstream_gene_variant ; 2952.0bp to feature; MODIFIER silent_mutation Average:59.152; most accessible tissue: Callus, score: 91.854 N N N N
vg0808213475 A -> G LOC_Os08g13770-LOC_Os08g13780 intergenic_region ; MODIFIER silent_mutation Average:59.152; most accessible tissue: Callus, score: 91.854 N N N N
vg0808213475 A -> DEL N N silent_mutation Average:59.152; most accessible tissue: Callus, score: 91.854 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0808213475 NA 1.62E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808213475 NA 1.54E-06 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808213475 NA 4.29E-26 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808213475 NA 6.70E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808213475 NA 2.98E-12 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808213475 NA 4.32E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808213475 NA 9.92E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808213475 NA 2.63E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808213475 NA 6.62E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808213475 6.30E-06 4.86E-08 mr1334_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808213475 NA 1.61E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808213475 NA 5.67E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808213475 NA 1.17E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808213475 NA 3.79E-09 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808213475 NA 1.70E-11 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808213475 6.68E-08 NA mr1757_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808213475 NA 2.78E-12 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808213475 NA 3.13E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808213475 NA 1.02E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808213475 NA 1.58E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808213475 7.42E-06 6.22E-22 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808213475 6.84E-06 NA mr1987_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251