\
| Variant ID: vg0808078578 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 8078578 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 363. )
TTGTTGTTGGTCTTCTCACCATCTTTGTCTTCTCTTTTGCCTCTCCCAAGATTAGGACAATGCGAACGAAGATGATGAATTGAACCACATTCAAAGCAAC[G/A]
ATTTGGACCACCTCTTTTCCTGTTCCTGGCATTATTCATAGCTCGAGCAATTCTGTTAGCAACCAAAGCCAAATCCTCCTCCTCGATTTGTTCGAGTTGA
TCAACTCGAACAAATCGAGGAGGAGGATTTGGCTTTGGTTGCTAACAGAATTGCTCGAGCTATGAATAATGCCAGGAACAGGAAAAGAGGTGGTCCAAAT[C/T]
GTTGCTTTGAATGTGGTTCAATTCATCATCTTCGTTCGCATTGTCCTAATCTTGGGAGAGGCAAAAGAGAAGACAAAGATGGTGAGAAGACCAACAACAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.50% | 2.40% | 0.34% | 0.74% | NA |
| All Indica | 2759 | 95.60% | 4.10% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 97.20% | 0.00% | 0.46% | 2.31% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.60% | 9.70% | 0.67% | 0.00% | NA |
| Indica II | 465 | 96.80% | 3.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.40% | 5.30% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 98.40% | 0.00% | 0.13% | 1.43% | NA |
| Tropical Japonica | 504 | 98.80% | 0.00% | 0.20% | 0.99% | NA |
| Japonica Intermediate | 241 | 90.00% | 0.00% | 2.07% | 7.88% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 0.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0808078578 | G -> A | LOC_Os08g13590.1 | missense_variant ; p.Arg156Cys; MODERATE | nonsynonymous_codon ; R156C | Average:20.467; most accessible tissue: Zhenshan97 flag leaf, score: 31.305 | benign |
0.467 |
DELETERIOUS | 0.02 |
| vg0808078578 | G -> DEL | LOC_Os08g13590.1 | N | frameshift_variant | Average:20.467; most accessible tissue: Zhenshan97 flag leaf, score: 31.305 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0808078578 | NA | 6.62E-06 | mr1020 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808078578 | NA | 1.56E-06 | mr1021 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808078578 | NA | 1.92E-06 | mr1032 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808078578 | NA | 3.94E-07 | mr1165 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808078578 | NA | 7.58E-06 | mr1478 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808078578 | NA | 5.04E-06 | mr1553 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808078578 | NA | 3.81E-07 | mr1060_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808078578 | NA | 1.51E-07 | mr1060_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808078578 | NA | 4.18E-07 | mr1125_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808078578 | NA | 1.63E-08 | mr1165_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808078578 | NA | 9.18E-06 | mr1268_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808078578 | NA | 2.76E-07 | mr1477_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808078578 | NA | 3.29E-08 | mr1478_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808078578 | NA | 2.82E-06 | mr1616_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808078578 | NA | 9.38E-06 | mr1616_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808078578 | NA | 6.36E-07 | mr1653_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808078578 | NA | 2.44E-07 | mr1971_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808078578 | NA | 6.26E-06 | mr1996_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |