\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808078578:

Variant ID: vg0808078578 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 8078578
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 363. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTTGTTGGTCTTCTCACCATCTTTGTCTTCTCTTTTGCCTCTCCCAAGATTAGGACAATGCGAACGAAGATGATGAATTGAACCACATTCAAAGCAAC[G/A]
ATTTGGACCACCTCTTTTCCTGTTCCTGGCATTATTCATAGCTCGAGCAATTCTGTTAGCAACCAAAGCCAAATCCTCCTCCTCGATTTGTTCGAGTTGA

Reverse complement sequence

TCAACTCGAACAAATCGAGGAGGAGGATTTGGCTTTGGTTGCTAACAGAATTGCTCGAGCTATGAATAATGCCAGGAACAGGAAAAGAGGTGGTCCAAAT[C/T]
GTTGCTTTGAATGTGGTTCAATTCATCATCTTCGTTCGCATTGTCCTAATCTTGGGAGAGGCAAAAGAGAAGACAAAGATGGTGAGAAGACCAACAACAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.50% 2.40% 0.34% 0.74% NA
All Indica  2759 95.60% 4.10% 0.25% 0.00% NA
All Japonica  1512 97.20% 0.00% 0.46% 2.31% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 89.60% 9.70% 0.67% 0.00% NA
Indica II  465 96.80% 3.00% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 94.40% 5.30% 0.25% 0.00% NA
Temperate Japonica  767 98.40% 0.00% 0.13% 1.43% NA
Tropical Japonica  504 98.80% 0.00% 0.20% 0.99% NA
Japonica Intermediate  241 90.00% 0.00% 2.07% 7.88% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 0.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0808078578 G -> A LOC_Os08g13590.1 missense_variant ; p.Arg156Cys; MODERATE nonsynonymous_codon ; R156C Average:20.467; most accessible tissue: Zhenshan97 flag leaf, score: 31.305 benign 0.467 DELETERIOUS 0.02
vg0808078578 G -> DEL LOC_Os08g13590.1 N frameshift_variant Average:20.467; most accessible tissue: Zhenshan97 flag leaf, score: 31.305 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0808078578 NA 6.62E-06 mr1020 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578 NA 1.56E-06 mr1021 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578 NA 1.92E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578 NA 3.94E-07 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578 NA 7.58E-06 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578 NA 5.04E-06 mr1553 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578 NA 3.81E-07 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578 NA 1.51E-07 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578 NA 4.18E-07 mr1125_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578 NA 1.63E-08 mr1165_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578 NA 9.18E-06 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578 NA 2.76E-07 mr1477_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578 NA 3.29E-08 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578 NA 2.82E-06 mr1616_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578 NA 9.38E-06 mr1616_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578 NA 6.36E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578 NA 2.44E-07 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578 NA 6.26E-06 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251