\
| Variant ID: vg0808077570 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 8077570 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.09, others allele: 0.00, population size: 186. )
GATTTTGAAGAAGATGCACTCATAGTAGACATGATACCAGTAGATTTAAACACAGTTTTGTTAGTATCAGGTTTAACCAAAATCTCACCACTTCTAGCAC[T/C]
AACACCTAACACAACAGGAGGATGTCTAGAATTATGAGCATAAGGATTAAAACCTAAACCACGGTTATGTGTGCTAACCTTTGATTGATCCAAAATCATG
CATGATTTTGGATCAATCAAAGGTTAGCACACATAACCGTGGTTTAGGTTTTAATCCTTATGCTCATAATTCTAGACATCCTCCTGTTGTGTTAGGTGTT[A/G]
GTGCTAGAAGTGGTGAGATTTTGGTTAAACCTGATACTAACAAAACTGTGTTTAAATCTACTGGTATCATGTCTACTATGAGTGCATCTTCTTCAAAATC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.30% | 34.40% | 0.55% | 1.69% | NA |
| All Indica | 2759 | 90.40% | 5.90% | 0.72% | 2.90% | NA |
| All Japonica | 1512 | 10.30% | 89.40% | 0.26% | 0.00% | NA |
| Aus | 269 | 95.90% | 3.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 87.70% | 9.70% | 0.84% | 1.68% | NA |
| Indica II | 465 | 94.40% | 4.70% | 0.65% | 0.22% | NA |
| Indica III | 913 | 91.90% | 2.60% | 0.44% | 5.04% | NA |
| Indica Intermediate | 786 | 88.40% | 7.60% | 1.02% | 2.93% | NA |
| Temperate Japonica | 767 | 2.90% | 97.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 20.80% | 79.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 12.00% | 87.10% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 29.20% | 70.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 62.20% | 36.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0808077570 | T -> C | LOC_Os08g13600.1 | upstream_gene_variant ; 2773.0bp to feature; MODIFIER | silent_mutation | Average:23.253; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0808077570 | T -> C | LOC_Os08g13590.1 | intron_variant ; MODIFIER | silent_mutation | Average:23.253; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0808077570 | T -> DEL | N | N | silent_mutation | Average:23.253; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0808077570 | NA | 8.17E-06 | mr1209 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808077570 | NA | 4.13E-15 | mr1376 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808077570 | NA | 4.13E-15 | mr1431 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808077570 | NA | 7.61E-14 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808077570 | NA | 3.02E-10 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808077570 | 2.51E-06 | 5.45E-07 | mr1098_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808077570 | 5.30E-06 | 1.34E-06 | mr1114_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808077570 | 9.39E-06 | NA | mr1123_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808077570 | 5.11E-06 | 1.02E-06 | mr1150_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808077570 | 1.37E-06 | 9.86E-07 | mr1242_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |