Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0808072179:

Variant ID: vg0808072179 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 8072179
Reference Allele: AAlternative Allele: G,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.74, A: 0.27, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


CACACAATAACTCCATCGTATGCCATATAGAATCTCCATCAACCACGTGCATCAACTCTAGCCTAAGTATCCCGCATGATCTCTGACCATCACGGACGTC[A/G,T]
CCTTATCCCCAAGCCGACTCCCGGTCCATCACCGCAAATACTCTCCCGAGACATCGAGTCACCTACACATGGAACAAACAAAGAAACCATATTCCGAGAC

Reverse complement sequence

GTCTCGGAATATGGTTTCTTTGTTTGTTCCATGTGTAGGTGACTCGATGTCTCGGGAGAGTATTTGCGGTGATGGACCGGGAGTCGGCTTGGGGATAAGG[T/C,A]
GACGTCCGTGATGGTCAGAGATCATGCGGGATACTTAGGCTAGAGTTGATGCACGTGGTTGATGGAGATTCTATATGGCATACGATGGAGTTATTGTGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.80% 31.70% 6.67% 1.82% T: 0.02%
All Indica  2759 89.30% 4.70% 5.94% 0.04% NA
All Japonica  1512 10.30% 83.90% 0.33% 5.49% NA
Aus  269 52.40% 1.10% 46.10% 0.00% T: 0.37%
Indica I  595 91.30% 8.10% 0.67% 0.00% NA
Indica II  465 70.80% 5.40% 23.66% 0.22% NA
Indica III  913 97.50% 1.50% 0.99% 0.00% NA
Indica Intermediate  786 89.40% 5.30% 5.22% 0.00% NA
Temperate Japonica  767 2.70% 95.20% 0.13% 1.96% NA
Tropical Japonica  504 20.60% 76.00% 0.60% 2.78% NA
Japonica Intermediate  241 12.40% 64.70% 0.41% 22.41% NA
VI/Aromatic  96 10.40% 70.80% 18.75% 0.00% NA
Intermediate  90 58.90% 34.40% 4.44% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0808072179 A -> G LOC_Os08g13580.1 upstream_gene_variant ; 2196.0bp to feature; MODIFIER silent_mutation Average:31.305; most accessible tissue: Zhenshan97 flag leaf, score: 81.41 N N N N
vg0808072179 A -> G LOC_Os08g13590.1 downstream_gene_variant ; 1614.0bp to feature; MODIFIER silent_mutation Average:31.305; most accessible tissue: Zhenshan97 flag leaf, score: 81.41 N N N N
vg0808072179 A -> G LOC_Os08g13580-LOC_Os08g13590 intergenic_region ; MODIFIER silent_mutation Average:31.305; most accessible tissue: Zhenshan97 flag leaf, score: 81.41 N N N N
vg0808072179 A -> T LOC_Os08g13580.1 upstream_gene_variant ; 2196.0bp to feature; MODIFIER silent_mutation Average:31.305; most accessible tissue: Zhenshan97 flag leaf, score: 81.41 N N N N
vg0808072179 A -> T LOC_Os08g13590.1 downstream_gene_variant ; 1614.0bp to feature; MODIFIER silent_mutation Average:31.305; most accessible tissue: Zhenshan97 flag leaf, score: 81.41 N N N N
vg0808072179 A -> T LOC_Os08g13580-LOC_Os08g13590 intergenic_region ; MODIFIER silent_mutation Average:31.305; most accessible tissue: Zhenshan97 flag leaf, score: 81.41 N N N N
vg0808072179 A -> DEL N N silent_mutation Average:31.305; most accessible tissue: Zhenshan97 flag leaf, score: 81.41 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0808072179 A G -0.01 -0.01 -0.01 -0.01 0.0 0.0
vg0808072179 A T -0.02 -0.02 -0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0808072179 NA 6.18E-13 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808072179 NA 1.67E-11 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808072179 NA 2.59E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808072179 NA 1.31E-07 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808072179 8.39E-06 2.55E-09 mr1607_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808072179 NA 8.34E-12 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808072179 NA 1.07E-07 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808072179 NA 2.52E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251