\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808052783:

Variant ID: vg0808052783 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 8052783
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


CTCGCATTGACTAGGTAGTTGACTCAACGGTCGGCTACGAGCTGCTCAGTTTTTTGGATTGCTACTCAGGATATCATCAGATCCATTTAAAGGAGTCCGA[T/C]
TGCTTGAAGACTTCATTCATTACGCCCTTCGGGGCCTACTGCTACATCACCATGCCTTTTGGATTAAAGAACGCAGGAGCAACTTATCAACGAATGATCC

Reverse complement sequence

GGATCATTCGTTGATAAGTTGCTCCTGCGTTCTTTAATCCAAAAGGCATGGTGATGTAGCAGTAGGCCCCGAAGGGCGTAATGAATGAAGTCTTCAAGCA[A/G]
TCGGACTCCTTTAAATGGATCTGATGATATCCTGAGTAGCAATCCAAAAAACTGAGCAGCTCGTAGCCGACCGTTGAGTCAACTACCTAGTCAATGCGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.70% 31.20% 0.11% 0.00% NA
All Indica  2759 95.80% 4.20% 0.04% 0.00% NA
All Japonica  1512 11.60% 88.10% 0.26% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 91.30% 8.60% 0.17% 0.00% NA
Indica II  465 95.70% 4.30% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 94.80% 5.20% 0.00% 0.00% NA
Temperate Japonica  767 3.00% 96.90% 0.13% 0.00% NA
Tropical Japonica  504 21.80% 78.00% 0.20% 0.00% NA
Japonica Intermediate  241 17.80% 81.30% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 72.20% 27.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0808052783 T -> C LOC_Os08g13530.1 upstream_gene_variant ; 4964.0bp to feature; MODIFIER silent_mutation Average:54.87; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 N N N N
vg0808052783 T -> C LOC_Os08g13550.1 upstream_gene_variant ; 638.0bp to feature; MODIFIER silent_mutation Average:54.87; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 N N N N
vg0808052783 T -> C LOC_Os08g13540.1 downstream_gene_variant ; 602.0bp to feature; MODIFIER silent_mutation Average:54.87; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 N N N N
vg0808052783 T -> C LOC_Os08g13560.1 downstream_gene_variant ; 3019.0bp to feature; MODIFIER silent_mutation Average:54.87; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 N N N N
vg0808052783 T -> C LOC_Os08g13540-LOC_Os08g13550 intergenic_region ; MODIFIER silent_mutation Average:54.87; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0808052783 NA 6.00E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783 NA 1.69E-14 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783 NA 5.11E-12 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783 NA 2.89E-11 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783 NA 1.45E-16 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783 NA 1.58E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783 NA 1.76E-12 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783 NA 2.82E-14 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783 NA 5.82E-16 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783 NA 7.77E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783 NA 9.71E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783 NA 1.34E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783 NA 7.37E-14 mr1714_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783 NA 5.78E-16 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783 NA 1.55E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783 NA 5.47E-12 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783 NA 1.60E-09 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783 NA 1.19E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783 NA 2.26E-24 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251