Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808052783:

Variant ID: vg0808052783 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 8052783
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

CTCGCATTGACTAGGTAGTTGACTCAACGGTCGGCTACGAGCTGCTCAGTTTTTTGGATTGCTACTCAGGATATCATCAGATCCATTTAAAGGAGTCCGA[T/C]
TGCTTGAAGACTTCATTCATTACGCCCTTCGGGGCCTACTGCTACATCACCATGCCTTTTGGATTAAAGAACGCAGGAGCAACTTATCAACGAATGATCC

Reverse complement sequence

GGATCATTCGTTGATAAGTTGCTCCTGCGTTCTTTAATCCAAAAGGCATGGTGATGTAGCAGTAGGCCCCGAAGGGCGTAATGAATGAAGTCTTCAAGCA[A/G]
TCGGACTCCTTTAAATGGATCTGATGATATCCTGAGTAGCAATCCAAAAAACTGAGCAGCTCGTAGCCGACCGTTGAGTCAACTACCTAGTCAATGCGAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.70%	31.20%	0.11%	0.00%	NA
All Indica	2759	95.80%	4.20%	0.04%	0.00%	NA
All Japonica	1512	11.60%	88.10%	0.26%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	91.30%	8.60%	0.17%	0.00%	NA
Indica II	465	95.70%	4.30%	0.00%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	94.80%	5.20%	0.00%	0.00%	NA
Temperate Japonica	767	3.00%	96.90%	0.13%	0.00%	NA
Tropical Japonica	504	21.80%	78.00%	0.20%	0.00%	NA
Japonica Intermediate	241	17.80%	81.30%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	72.20%	27.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0808052783	T -> C	LOC_Os08g13530.1	upstream_gene_variant ; 4964.0bp to feature; MODIFIER	silent_mutation	Average:54.87; most accessible tissue: Zhenshan97 flag leaf, score: 73.475	N	N	N	N
vg0808052783	T -> C	LOC_Os08g13550.1	upstream_gene_variant ; 638.0bp to feature; MODIFIER	silent_mutation	Average:54.87; most accessible tissue: Zhenshan97 flag leaf, score: 73.475	N	N	N	N
vg0808052783	T -> C	LOC_Os08g13540.1	downstream_gene_variant ; 602.0bp to feature; MODIFIER	silent_mutation	Average:54.87; most accessible tissue: Zhenshan97 flag leaf, score: 73.475	N	N	N	N
vg0808052783	T -> C	LOC_Os08g13560.1	downstream_gene_variant ; 3019.0bp to feature; MODIFIER	silent_mutation	Average:54.87; most accessible tissue: Zhenshan97 flag leaf, score: 73.475	N	N	N	N
vg0808052783	T -> C	LOC_Os08g13540-LOC_Os08g13550	intergenic_region ; MODIFIER	silent_mutation	Average:54.87; most accessible tissue: Zhenshan97 flag leaf, score: 73.475	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0808052783	NA	6.00E-12	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783	NA	1.69E-14	mr1909	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783	NA	5.11E-12	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783	NA	2.89E-11	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783	NA	1.45E-16	mr1146_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783	NA	1.58E-09	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783	NA	1.76E-12	mr1258_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783	NA	2.82E-14	mr1529_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783	NA	5.82E-16	mr1557_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783	NA	7.77E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783	NA	9.71E-14	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783	NA	1.34E-12	mr1641_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783	NA	7.37E-14	mr1714_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783	NA	5.78E-16	mr1767_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783	NA	1.55E-11	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783	NA	5.47E-12	mr1853_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783	NA	1.60E-09	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783	NA	1.19E-08	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808052783	NA	2.26E-24	mr1968_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251