\
| Variant ID: vg0808043321 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 8043321 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 107. )
AGTGGATTTGGCAAAGAATTGGATTCGAAGAACAGAGTATGCATCGGTTGCGAAGGCATCAGCTAGAGTCTGCATCGGCTGAGATGGATCGGACAGAGGA[C/T]
AGCCGATACAGCCGATTTCATTGAGATGGTTATAAAACTGTCTCTGGAATCGATCAACGTGCTACGAAAGGATTGTCACGATGGAGATAAGCTCTCAGAT
ATCTGAGAGCTTATCTCCATCGTGACAATCCTTTCGTAGCACGTTGATCGATTCCAGAGACAGTTTTATAACCATCTCAATGAAATCGGCTGTATCGGCT[G/A]
TCCTCTGTCCGATCCATCTCAGCCGATGCAGACTCTAGCTGATGCCTTCGCAACCGATGCATACTCTGTTCTTCGAATCCAATTCTTTGCCAAATCCACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.20% | 28.80% | 7.77% | 14.26% | NA |
| All Indica | 2759 | 18.70% | 44.20% | 12.90% | 24.18% | NA |
| All Japonica | 1512 | 97.30% | 2.30% | 0.26% | 0.13% | NA |
| Aus | 269 | 98.10% | 1.50% | 0.37% | 0.00% | NA |
| Indica I | 595 | 7.40% | 50.60% | 22.52% | 19.50% | NA |
| Indica II | 465 | 47.10% | 27.30% | 8.39% | 17.20% | NA |
| Indica III | 913 | 13.50% | 45.60% | 10.41% | 30.56% | NA |
| Indica Intermediate | 786 | 16.50% | 47.80% | 11.20% | 24.43% | NA |
| Temperate Japonica | 767 | 97.50% | 1.80% | 0.39% | 0.26% | NA |
| Tropical Japonica | 504 | 97.80% | 2.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 30.20% | 69.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 36.70% | 6.67% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0808043321 | C -> T | LOC_Os08g13510.1 | upstream_gene_variant ; 4929.0bp to feature; MODIFIER | silent_mutation | Average:47.896; most accessible tissue: Zhenshan97 young leaf, score: 68.315 | N | N | N | N |
| vg0808043321 | C -> T | LOC_Os08g13520.1 | upstream_gene_variant ; 2614.0bp to feature; MODIFIER | silent_mutation | Average:47.896; most accessible tissue: Zhenshan97 young leaf, score: 68.315 | N | N | N | N |
| vg0808043321 | C -> T | LOC_Os08g13530.1 | downstream_gene_variant ; 3640.0bp to feature; MODIFIER | silent_mutation | Average:47.896; most accessible tissue: Zhenshan97 young leaf, score: 68.315 | N | N | N | N |
| vg0808043321 | C -> T | LOC_Os08g13520-LOC_Os08g13530 | intergenic_region ; MODIFIER | silent_mutation | Average:47.896; most accessible tissue: Zhenshan97 young leaf, score: 68.315 | N | N | N | N |
| vg0808043321 | C -> DEL | N | N | silent_mutation | Average:47.896; most accessible tissue: Zhenshan97 young leaf, score: 68.315 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0808043321 | NA | 2.52E-47 | mr1109 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808043321 | NA | 1.38E-17 | mr1253 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808043321 | NA | 2.00E-18 | mr1255 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808043321 | NA | 3.62E-09 | mr1317 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808043321 | 4.75E-06 | 4.05E-06 | mr1317 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808043321 | NA | 3.65E-09 | mr1610 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808043321 | NA | 2.16E-12 | mr1914 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808043321 | NA | 7.99E-12 | mr1927 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808043321 | NA | 6.92E-12 | mr1938 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |