\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808043321:

Variant ID: vg0808043321 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 8043321
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


AGTGGATTTGGCAAAGAATTGGATTCGAAGAACAGAGTATGCATCGGTTGCGAAGGCATCAGCTAGAGTCTGCATCGGCTGAGATGGATCGGACAGAGGA[C/T]
AGCCGATACAGCCGATTTCATTGAGATGGTTATAAAACTGTCTCTGGAATCGATCAACGTGCTACGAAAGGATTGTCACGATGGAGATAAGCTCTCAGAT

Reverse complement sequence

ATCTGAGAGCTTATCTCCATCGTGACAATCCTTTCGTAGCACGTTGATCGATTCCAGAGACAGTTTTATAACCATCTCAATGAAATCGGCTGTATCGGCT[G/A]
TCCTCTGTCCGATCCATCTCAGCCGATGCAGACTCTAGCTGATGCCTTCGCAACCGATGCATACTCTGTTCTTCGAATCCAATTCTTTGCCAAATCCACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.20% 28.80% 7.77% 14.26% NA
All Indica  2759 18.70% 44.20% 12.90% 24.18% NA
All Japonica  1512 97.30% 2.30% 0.26% 0.13% NA
Aus  269 98.10% 1.50% 0.37% 0.00% NA
Indica I  595 7.40% 50.60% 22.52% 19.50% NA
Indica II  465 47.10% 27.30% 8.39% 17.20% NA
Indica III  913 13.50% 45.60% 10.41% 30.56% NA
Indica Intermediate  786 16.50% 47.80% 11.20% 24.43% NA
Temperate Japonica  767 97.50% 1.80% 0.39% 0.26% NA
Tropical Japonica  504 97.80% 2.00% 0.20% 0.00% NA
Japonica Intermediate  241 95.40% 4.60% 0.00% 0.00% NA
VI/Aromatic  96 30.20% 69.80% 0.00% 0.00% NA
Intermediate  90 51.10% 36.70% 6.67% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0808043321 C -> T LOC_Os08g13510.1 upstream_gene_variant ; 4929.0bp to feature; MODIFIER silent_mutation Average:47.896; most accessible tissue: Zhenshan97 young leaf, score: 68.315 N N N N
vg0808043321 C -> T LOC_Os08g13520.1 upstream_gene_variant ; 2614.0bp to feature; MODIFIER silent_mutation Average:47.896; most accessible tissue: Zhenshan97 young leaf, score: 68.315 N N N N
vg0808043321 C -> T LOC_Os08g13530.1 downstream_gene_variant ; 3640.0bp to feature; MODIFIER silent_mutation Average:47.896; most accessible tissue: Zhenshan97 young leaf, score: 68.315 N N N N
vg0808043321 C -> T LOC_Os08g13520-LOC_Os08g13530 intergenic_region ; MODIFIER silent_mutation Average:47.896; most accessible tissue: Zhenshan97 young leaf, score: 68.315 N N N N
vg0808043321 C -> DEL N N silent_mutation Average:47.896; most accessible tissue: Zhenshan97 young leaf, score: 68.315 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0808043321 NA 2.52E-47 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808043321 NA 1.38E-17 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808043321 NA 2.00E-18 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808043321 NA 3.62E-09 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808043321 4.75E-06 4.05E-06 mr1317 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808043321 NA 3.65E-09 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808043321 NA 2.16E-12 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808043321 NA 7.99E-12 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808043321 NA 6.92E-12 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251