Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808043321:

Variant ID: vg0808043321 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 8043321
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

AGTGGATTTGGCAAAGAATTGGATTCGAAGAACAGAGTATGCATCGGTTGCGAAGGCATCAGCTAGAGTCTGCATCGGCTGAGATGGATCGGACAGAGGA[C/T]
AGCCGATACAGCCGATTTCATTGAGATGGTTATAAAACTGTCTCTGGAATCGATCAACGTGCTACGAAAGGATTGTCACGATGGAGATAAGCTCTCAGAT

Reverse complement sequence

ATCTGAGAGCTTATCTCCATCGTGACAATCCTTTCGTAGCACGTTGATCGATTCCAGAGACAGTTTTATAACCATCTCAATGAAATCGGCTGTATCGGCT[G/A]
TCCTCTGTCCGATCCATCTCAGCCGATGCAGACTCTAGCTGATGCCTTCGCAACCGATGCATACTCTGTTCTTCGAATCCAATTCTTTGCCAAATCCACT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.20%	28.80%	7.77%	14.26%	NA
All Indica	2759	18.70%	44.20%	12.90%	24.18%	NA
All Japonica	1512	97.30%	2.30%	0.26%	0.13%	NA
Aus	269	98.10%	1.50%	0.37%	0.00%	NA
Indica I	595	7.40%	50.60%	22.52%	19.50%	NA
Indica II	465	47.10%	27.30%	8.39%	17.20%	NA
Indica III	913	13.50%	45.60%	10.41%	30.56%	NA
Indica Intermediate	786	16.50%	47.80%	11.20%	24.43%	NA
Temperate Japonica	767	97.50%	1.80%	0.39%	0.26%	NA
Tropical Japonica	504	97.80%	2.00%	0.20%	0.00%	NA
Japonica Intermediate	241	95.40%	4.60%	0.00%	0.00%	NA
VI/Aromatic	96	30.20%	69.80%	0.00%	0.00%	NA
Intermediate	90	51.10%	36.70%	6.67%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0808043321	C -> T	LOC_Os08g13510.1	upstream_gene_variant ; 4929.0bp to feature; MODIFIER	silent_mutation	Average:47.896; most accessible tissue: Zhenshan97 young leaf, score: 68.315	N	N	N	N
vg0808043321	C -> T	LOC_Os08g13520.1	upstream_gene_variant ; 2614.0bp to feature; MODIFIER	silent_mutation	Average:47.896; most accessible tissue: Zhenshan97 young leaf, score: 68.315	N	N	N	N
vg0808043321	C -> T	LOC_Os08g13530.1	downstream_gene_variant ; 3640.0bp to feature; MODIFIER	silent_mutation	Average:47.896; most accessible tissue: Zhenshan97 young leaf, score: 68.315	N	N	N	N
vg0808043321	C -> T	LOC_Os08g13520-LOC_Os08g13530	intergenic_region ; MODIFIER	silent_mutation	Average:47.896; most accessible tissue: Zhenshan97 young leaf, score: 68.315	N	N	N	N
vg0808043321	C -> DEL	N	N	silent_mutation	Average:47.896; most accessible tissue: Zhenshan97 young leaf, score: 68.315	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0808043321	NA	2.52E-47	mr1109	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808043321	NA	1.38E-17	mr1253	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808043321	NA	2.00E-18	mr1255	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808043321	NA	3.62E-09	mr1317	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808043321	4.75E-06	4.05E-06	mr1317	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808043321	NA	3.65E-09	mr1610	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808043321	NA	2.16E-12	mr1914	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808043321	NA	7.99E-12	mr1927	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808043321	NA	6.92E-12	mr1938	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251