Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0807919580:

Variant ID: vg0807919580 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 7919580
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGATCATGGAATTATATTATGTATGAAATATATATAACATGGGAATGAAATTTTACAATGAAATGCACATAAAATTGAAACTGGAACAATTTATAACACT[T/G]
CTGGAATTCTTCACAACAAAAACTTGTGAACTCTATTCCACTGAGAATCCCCAAACAGCTCCATGGTAAAACTAAAGCCATCCATGTTACAAGTATCCAA

Reverse complement sequence

TTGGATACTTGTAACATGGATGGCTTTAGTTTTACCATGGAGCTGTTTGGGGATTCTCAGTGGAATAGAGTTCACAAGTTTTTGTTGTGAAGAATTCCAG[A/C]
AGTGTTATAAATTGTTCCAGTTTCAATTTTATGTGCATTTCATTGTAAAATTTCATTCCCATGTTATATATATTTCATACATAATATAATTCCATGATCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.70%	30.30%	0.02%	0.00%	NA
All Indica	2759	97.60%	2.40%	0.04%	0.00%	NA
All Japonica	1512	11.40%	88.60%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	94.60%	5.40%	0.00%	0.00%	NA
Indica II	465	97.20%	2.60%	0.22%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	97.60%	2.40%	0.00%	0.00%	NA
Temperate Japonica	767	2.50%	97.50%	0.00%	0.00%	NA
Tropical Japonica	504	22.40%	77.60%	0.00%	0.00%	NA
Japonica Intermediate	241	17.00%	83.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	71.10%	28.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0807919580	T -> G	LOC_Os08g13320.1	downstream_gene_variant ; 3076.0bp to feature; MODIFIER	silent_mutation	Average:42.705; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg0807919580	T -> G	LOC_Os08g13330.1	downstream_gene_variant ; 1397.0bp to feature; MODIFIER	silent_mutation	Average:42.705; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg0807919580	T -> G	LOC_Os08g13320-LOC_Os08g13330	intergenic_region ; MODIFIER	silent_mutation	Average:42.705; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0807919580	9.83E-06	1.21E-07	mr1334	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807919580	NA	3.25E-34	mr1350	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807919580	NA	2.42E-06	mr1415	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807919580	NA	2.42E-06	mr1567	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807919580	NA	1.11E-15	mr1909	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807919580	NA	3.60E-12	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807919580	NA	9.03E-06	mr1219_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807919580	NA	2.49E-09	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807919580	NA	5.03E-12	mr1258_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807919580	5.02E-06	NA	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807919580	3.53E-09	1.60E-12	mr1334_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807919580	NA	4.60E-14	mr1529_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807919580	NA	2.14E-19	mr1731_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807919580	NA	2.78E-08	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807919580	NA	9.21E-08	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807919580	NA	9.76E-23	mr1968_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807919580	NA	3.60E-51	mr1991_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251