\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0807910368:

Variant ID: vg0807910368 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 7910368
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACTTCTCAGCCATTTCTCAAGAGAGGTAAGTCAGGAGGAAGCCGAGCACTTATCGCTCGGGCACGCACCGCACTTCACATCTAGCAATTCCACCAAAAT[T/C]
AAATTTAAATTGAACCTACACATTGAGAAAAAAACAAATTCAAGAATGAATATATATAGTATCACTATTATATTCATATCCAAATTTATTTTTTTATACT

Reverse complement sequence

AGTATAAAAAAATAAATTTGGATATGAATATAATAGTGATACTATATATATTCATTCTTGAATTTGTTTTTTTCTCAATGTGTAGGTTCAATTTAAATTT[A/G]
ATTTTGGTGGAATTGCTAGATGTGAAGTGCGGTGCGTGCCCGAGCGATAAGTGCTCGGCTTCCTCCTGACTTACCTCTCTTGAGAAATGGCTGAGAAGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.90% 32.10% 0.00% 0.00% NA
All Indica  2759 97.20% 2.80% 0.00% 0.00% NA
All Japonica  1512 11.40% 88.60% 0.00% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 95.00% 5.00% 0.00% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 98.50% 1.50% 0.00% 0.00% NA
Indica Intermediate  786 97.50% 2.50% 0.00% 0.00% NA
Temperate Japonica  767 2.70% 97.30% 0.00% 0.00% NA
Tropical Japonica  504 22.60% 77.40% 0.00% 0.00% NA
Japonica Intermediate  241 15.80% 84.20% 0.00% 0.00% NA
VI/Aromatic  96 32.30% 67.70% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0807910368 T -> C LOC_Os08g13310.1 upstream_gene_variant ; 1356.0bp to feature; MODIFIER silent_mutation Average:66.267; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0807910368 T -> C LOC_Os08g13320.1 upstream_gene_variant ; 1431.0bp to feature; MODIFIER silent_mutation Average:66.267; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0807910368 T -> C LOC_Os08g13300.1 downstream_gene_variant ; 2598.0bp to feature; MODIFIER silent_mutation Average:66.267; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0807910368 T -> C LOC_Os08g13310-LOC_Os08g13320 intergenic_region ; MODIFIER silent_mutation Average:66.267; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0807910368 NA 1.38E-12 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807910368 NA 1.40E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807910368 2.77E-06 2.77E-06 mr1011 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807910368 NA 1.39E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807910368 NA 2.18E-12 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807910368 NA 1.39E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807910368 NA 1.16E-06 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807910368 NA 1.52E-12 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807910368 NA 1.17E-14 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807910368 NA 9.54E-12 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807910368 NA 1.14E-19 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251