\
| Variant ID: vg0807910368 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 7910368 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CACTTCTCAGCCATTTCTCAAGAGAGGTAAGTCAGGAGGAAGCCGAGCACTTATCGCTCGGGCACGCACCGCACTTCACATCTAGCAATTCCACCAAAAT[T/C]
AAATTTAAATTGAACCTACACATTGAGAAAAAAACAAATTCAAGAATGAATATATATAGTATCACTATTATATTCATATCCAAATTTATTTTTTTATACT
AGTATAAAAAAATAAATTTGGATATGAATATAATAGTGATACTATATATATTCATTCTTGAATTTGTTTTTTTCTCAATGTGTAGGTTCAATTTAAATTT[A/G]
ATTTTGGTGGAATTGCTAGATGTGAAGTGCGGTGCGTGCCCGAGCGATAAGTGCTCGGCTTCCTCCTGACTTACCTCTCTTGAGAAATGGCTGAGAAGTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.90% | 32.10% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 11.40% | 88.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 2.70% | 97.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 22.60% | 77.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 15.80% | 84.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 32.30% | 67.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 31.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0807910368 | T -> C | LOC_Os08g13310.1 | upstream_gene_variant ; 1356.0bp to feature; MODIFIER | silent_mutation | Average:66.267; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0807910368 | T -> C | LOC_Os08g13320.1 | upstream_gene_variant ; 1431.0bp to feature; MODIFIER | silent_mutation | Average:66.267; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0807910368 | T -> C | LOC_Os08g13300.1 | downstream_gene_variant ; 2598.0bp to feature; MODIFIER | silent_mutation | Average:66.267; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0807910368 | T -> C | LOC_Os08g13310-LOC_Os08g13320 | intergenic_region ; MODIFIER | silent_mutation | Average:66.267; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0807910368 | NA | 1.38E-12 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807910368 | NA | 1.40E-06 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807910368 | 2.77E-06 | 2.77E-06 | mr1011 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807910368 | NA | 1.39E-14 | mr1376 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807910368 | NA | 2.18E-12 | mr1386 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807910368 | NA | 1.39E-14 | mr1431 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807910368 | NA | 1.16E-06 | mr1587 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807910368 | NA | 1.52E-12 | mr1667 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807910368 | NA | 1.17E-14 | mr1909 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807910368 | NA | 9.54E-12 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807910368 | NA | 1.14E-19 | mr1731_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |