\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0807909279:

Variant ID: vg0807909279 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 7909279
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACTGGCATGCATGGTGCTAATTTTAGTTGATGCTTTCCAAATTTTTATTGTCAGCGGGCGGGGCCAGAAATTAACGCGCGCGGGCAAGCATGAGCGATC[A/G]
AGAAGTCTCATAAACGCGTGAAAATAGGACGTGGGATATGGGATACGTGCACGAAAATAGGACGTGGGATGGGCTACGCGCTGGGAAGGCCGAGGGCGCG

Reverse complement sequence

CGCGCCCTCGGCCTTCCCAGCGCGTAGCCCATCCCACGTCCTATTTTCGTGCACGTATCCCATATCCCACGTCCTATTTTCACGCGTTTATGAGACTTCT[T/C]
GATCGCTCATGCTTGCCCGCGCGCGTTAATTTCTGGCCCCGCCCGCTGACAATAAAAATTTGGAAAGCATCAACTAAAATTAGCACCATGCATGCCAGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.90% 32.10% 0.00% 0.00% NA
All Indica  2759 97.20% 2.80% 0.00% 0.00% NA
All Japonica  1512 11.30% 88.70% 0.00% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 95.00% 5.00% 0.00% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 98.50% 1.50% 0.00% 0.00% NA
Indica Intermediate  786 97.60% 2.40% 0.00% 0.00% NA
Temperate Japonica  767 2.50% 97.50% 0.00% 0.00% NA
Tropical Japonica  504 22.60% 77.40% 0.00% 0.00% NA
Japonica Intermediate  241 15.80% 84.20% 0.00% 0.00% NA
VI/Aromatic  96 32.30% 67.70% 0.00% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0807909279 A -> G LOC_Os08g13310.1 upstream_gene_variant ; 267.0bp to feature; MODIFIER silent_mutation Average:66.778; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0807909279 A -> G LOC_Os08g13320.1 upstream_gene_variant ; 2520.0bp to feature; MODIFIER silent_mutation Average:66.778; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0807909279 A -> G LOC_Os08g13300.1 downstream_gene_variant ; 1509.0bp to feature; MODIFIER silent_mutation Average:66.778; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0807909279 A -> G LOC_Os08g13310-LOC_Os08g13320 intergenic_region ; MODIFIER silent_mutation Average:66.778; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0807909279 NA 3.84E-07 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807909279 NA 5.80E-06 mr1007 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807909279 NA 4.13E-07 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807909279 NA 3.50E-34 mr1350 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807909279 NA 2.23E-12 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807909279 1.26E-06 3.10E-08 mr1415 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807909279 1.26E-06 3.10E-08 mr1567 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807909279 NA 4.33E-06 mr1806 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807909279 NA 3.01E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807909279 NA 1.43E-06 mr1986 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807909279 NA 7.16E-06 mr1006_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807909279 NA 8.11E-06 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807909279 NA 7.75E-08 mr1334_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251