Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0807847137:

Variant ID: vg0807847137 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 7847137
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:

ATAAATCATTTTTCCCTCTTTCAGAAATCAATTCCTTATTCCAAAATTCCATGAATCATTTTCCTTGGTCAGTGACTGTCAATAATATTCTTGAGAATAT[T/A]
ATTTCCATAAATTCTGACAAAACATTTCCTTGTCCAGAAAATCCATTTAGACCTCCAAAATTCATATCCCTCGATCCGTAGCTCCGATCGCCTCCGTTCC

Reverse complement sequence

GGAACGGAGGCGATCGGAGCTACGGATCGAGGGATATGAATTTTGGAGGTCTAAATGGATTTTCTGGACAAGGAAATGTTTTGTCAGAATTTATGGAAAT[A/T]
ATATTCTCAAGAATATTATTGACAGTCACTGACCAAGGAAAATGATTCATGGAATTTTGGAATAAGGAATTGATTTCTGAAAGAGGGAAAAATGATTTAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.20%	3.90%	20.23%	44.63%	NA
All Indica	2759	8.20%	6.60%	25.92%	59.30%	NA
All Japonica	1512	77.20%	0.10%	9.72%	12.96%	NA
Aus	269	12.30%	0.00%	25.65%	62.08%	NA
Indica I	595	3.50%	1.50%	13.61%	81.34%	NA
Indica II	465	5.80%	10.30%	27.31%	56.56%	NA
Indica III	913	12.70%	7.90%	33.41%	46.00%	NA
Indica Intermediate	786	7.80%	6.90%	25.70%	59.67%	NA
Temperate Japonica	767	61.10%	0.30%	15.91%	22.69%	NA
Tropical Japonica	504	98.20%	0.00%	0.20%	1.59%	NA
Japonica Intermediate	241	84.20%	0.00%	9.96%	5.81%	NA
VI/Aromatic	96	11.50%	0.00%	11.46%	77.08%	NA
Intermediate	90	43.30%	1.10%	15.56%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0807847137	T -> A	LOC_Os08g13200.1	upstream_gene_variant ; 409.0bp to feature; MODIFIER	silent_mutation	Average:4.877; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0807847137	T -> A	LOC_Os08g13190.1	downstream_gene_variant ; 3159.0bp to feature; MODIFIER	silent_mutation	Average:4.877; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0807847137	T -> A	LOC_Os08g13200-LOC_Os08g13210	intergenic_region ; MODIFIER	silent_mutation	Average:4.877; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0807847137	T -> DEL	N	N	silent_mutation	Average:4.877; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0807847137	8.06E-06	NA	mr1096_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807847137	NA	9.30E-06	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807847137	6.04E-06	NA	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807847137	8.85E-06	NA	mr1200_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807847137	9.96E-07	1.98E-06	mr1294_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807847137	3.01E-06	NA	mr1299_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807847137	2.15E-06	4.45E-06	mr1494_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807847137	6.79E-06	NA	mr1505_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807847137	3.64E-06	5.99E-06	mr1604_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807847137	1.55E-06	NA	mr1653_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807847137	8.38E-06	NA	mr1823_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807847137	6.53E-06	NA	mr1838_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251