\
| Variant ID: vg0807847137 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 7847137 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 68. )
ATAAATCATTTTTCCCTCTTTCAGAAATCAATTCCTTATTCCAAAATTCCATGAATCATTTTCCTTGGTCAGTGACTGTCAATAATATTCTTGAGAATAT[T/A]
ATTTCCATAAATTCTGACAAAACATTTCCTTGTCCAGAAAATCCATTTAGACCTCCAAAATTCATATCCCTCGATCCGTAGCTCCGATCGCCTCCGTTCC
GGAACGGAGGCGATCGGAGCTACGGATCGAGGGATATGAATTTTGGAGGTCTAAATGGATTTTCTGGACAAGGAAATGTTTTGTCAGAATTTATGGAAAT[A/T]
ATATTCTCAAGAATATTATTGACAGTCACTGACCAAGGAAAATGATTCATGGAATTTTGGAATAAGGAATTGATTTCTGAAAGAGGGAAAAATGATTTAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.20% | 3.90% | 20.23% | 44.63% | NA |
| All Indica | 2759 | 8.20% | 6.60% | 25.92% | 59.30% | NA |
| All Japonica | 1512 | 77.20% | 0.10% | 9.72% | 12.96% | NA |
| Aus | 269 | 12.30% | 0.00% | 25.65% | 62.08% | NA |
| Indica I | 595 | 3.50% | 1.50% | 13.61% | 81.34% | NA |
| Indica II | 465 | 5.80% | 10.30% | 27.31% | 56.56% | NA |
| Indica III | 913 | 12.70% | 7.90% | 33.41% | 46.00% | NA |
| Indica Intermediate | 786 | 7.80% | 6.90% | 25.70% | 59.67% | NA |
| Temperate Japonica | 767 | 61.10% | 0.30% | 15.91% | 22.69% | NA |
| Tropical Japonica | 504 | 98.20% | 0.00% | 0.20% | 1.59% | NA |
| Japonica Intermediate | 241 | 84.20% | 0.00% | 9.96% | 5.81% | NA |
| VI/Aromatic | 96 | 11.50% | 0.00% | 11.46% | 77.08% | NA |
| Intermediate | 90 | 43.30% | 1.10% | 15.56% | 40.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0807847137 | T -> A | LOC_Os08g13200.1 | upstream_gene_variant ; 409.0bp to feature; MODIFIER | silent_mutation | Average:4.877; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0807847137 | T -> A | LOC_Os08g13190.1 | downstream_gene_variant ; 3159.0bp to feature; MODIFIER | silent_mutation | Average:4.877; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0807847137 | T -> A | LOC_Os08g13200-LOC_Os08g13210 | intergenic_region ; MODIFIER | silent_mutation | Average:4.877; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0807847137 | T -> DEL | N | N | silent_mutation | Average:4.877; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0807847137 | 8.06E-06 | NA | mr1096_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807847137 | NA | 9.30E-06 | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807847137 | 6.04E-06 | NA | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807847137 | 8.85E-06 | NA | mr1200_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807847137 | 9.96E-07 | 1.98E-06 | mr1294_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807847137 | 3.01E-06 | NA | mr1299_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807847137 | 2.15E-06 | 4.45E-06 | mr1494_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807847137 | 6.79E-06 | NA | mr1505_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807847137 | 3.64E-06 | 5.99E-06 | mr1604_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807847137 | 1.55E-06 | NA | mr1653_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807847137 | 8.38E-06 | NA | mr1823_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807847137 | 6.53E-06 | NA | mr1838_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |