\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0807847137:

Variant ID: vg0807847137 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 7847137
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


ATAAATCATTTTTCCCTCTTTCAGAAATCAATTCCTTATTCCAAAATTCCATGAATCATTTTCCTTGGTCAGTGACTGTCAATAATATTCTTGAGAATAT[T/A]
ATTTCCATAAATTCTGACAAAACATTTCCTTGTCCAGAAAATCCATTTAGACCTCCAAAATTCATATCCCTCGATCCGTAGCTCCGATCGCCTCCGTTCC

Reverse complement sequence

GGAACGGAGGCGATCGGAGCTACGGATCGAGGGATATGAATTTTGGAGGTCTAAATGGATTTTCTGGACAAGGAAATGTTTTGTCAGAATTTATGGAAAT[A/T]
ATATTCTCAAGAATATTATTGACAGTCACTGACCAAGGAAAATGATTCATGGAATTTTGGAATAAGGAATTGATTTCTGAAAGAGGGAAAAATGATTTAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.20% 3.90% 20.23% 44.63% NA
All Indica  2759 8.20% 6.60% 25.92% 59.30% NA
All Japonica  1512 77.20% 0.10% 9.72% 12.96% NA
Aus  269 12.30% 0.00% 25.65% 62.08% NA
Indica I  595 3.50% 1.50% 13.61% 81.34% NA
Indica II  465 5.80% 10.30% 27.31% 56.56% NA
Indica III  913 12.70% 7.90% 33.41% 46.00% NA
Indica Intermediate  786 7.80% 6.90% 25.70% 59.67% NA
Temperate Japonica  767 61.10% 0.30% 15.91% 22.69% NA
Tropical Japonica  504 98.20% 0.00% 0.20% 1.59% NA
Japonica Intermediate  241 84.20% 0.00% 9.96% 5.81% NA
VI/Aromatic  96 11.50% 0.00% 11.46% 77.08% NA
Intermediate  90 43.30% 1.10% 15.56% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0807847137 T -> A LOC_Os08g13200.1 upstream_gene_variant ; 409.0bp to feature; MODIFIER silent_mutation Average:4.877; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0807847137 T -> A LOC_Os08g13190.1 downstream_gene_variant ; 3159.0bp to feature; MODIFIER silent_mutation Average:4.877; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0807847137 T -> A LOC_Os08g13200-LOC_Os08g13210 intergenic_region ; MODIFIER silent_mutation Average:4.877; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0807847137 T -> DEL N N silent_mutation Average:4.877; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0807847137 8.06E-06 NA mr1096_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807847137 NA 9.30E-06 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807847137 6.04E-06 NA mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807847137 8.85E-06 NA mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807847137 9.96E-07 1.98E-06 mr1294_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807847137 3.01E-06 NA mr1299_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807847137 2.15E-06 4.45E-06 mr1494_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807847137 6.79E-06 NA mr1505_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807847137 3.64E-06 5.99E-06 mr1604_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807847137 1.55E-06 NA mr1653_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807847137 8.38E-06 NA mr1823_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807847137 6.53E-06 NA mr1838_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251