\
| Variant ID: vg0807832561 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 7832561 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTGTGAGCTCGTTGATGTACTCCTCCATAGCTTTACGATCTTCTCCTTCGAAGTCTTCCAATGCGACCGGTATCACATTAGATGGCTCCACCTCCGTCTT[A/G]
GATAGCGGCTTCGTCATGGCGAAGTCAAAGTTGAGTTGACGATGAACGGATCTCCTCCCCAGCAGAGTCGCCAAAAATCGTGTTGGCAACTTTTTGTGAC
GTCACAAAAAGTTGCCAACACGATTTTTGGCGACTCTGCTGGGGAGGAGATCCGTTCATCGTCAACTCAACTTTGACTTCGCCATGACGAAGCCGCTATC[T/C]
AAGACGGAGGTGGAGCCATCTAATGTGATACCGGTCGCATTGGAAGACTTCGAAGGAGAAGATCGTAAAGCTATGGAGGAGTACATCAACGAGCTCACAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.40% | 28.60% | 1.95% | 0.00% | NA |
| All Indica | 2759 | 95.80% | 0.90% | 3.30% | 0.00% | NA |
| All Japonica | 1512 | 14.40% | 85.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 96.10% | 2.20% | 1.72% | 0.00% | NA |
| Indica III | 913 | 91.50% | 0.40% | 8.11% | 0.00% | NA |
| Indica Intermediate | 786 | 98.00% | 1.00% | 1.02% | 0.00% | NA |
| Temperate Japonica | 767 | 7.00% | 93.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 20.80% | 79.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 24.10% | 75.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 28.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0807832561 | A -> G | LOC_Os08g13170.1 | synonymous_variant ; p.Ser6Ser; LOW | synonymous_codon | Average:59.512; most accessible tissue: Minghui63 young leaf, score: 85.236 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0807832561 | NA | 2.32E-07 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807832561 | 9.01E-06 | NA | mr1071_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807832561 | NA | 3.44E-15 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807832561 | 6.75E-06 | NA | mr1203_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807832561 | NA | 1.56E-23 | mr1350_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807832561 | NA | 3.56E-34 | mr1448_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807832561 | NA | 1.21E-44 | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807832561 | 2.76E-07 | 2.76E-07 | mr1542_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807832561 | NA | 7.24E-26 | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807832561 | NA | 8.83E-26 | mr1617_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807832561 | NA | 8.81E-21 | mr1968_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |