Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0807752750:

Variant ID: vg0807752750 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 7752750
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

AGTGAGAACCGAGAGGGTAGAGGGGTGGAGAGATAGGAGATCCATGAATCCGCCTCGGATCTCCGTATTCTTGGGGCCATCCCCCGTTAGCTACGCCTCT[A/G]
CTAGCATTGGCACGGAGGCCACCGCTTTGGCAGCCGCTGATGTCGTCGACCATAGTGCTCAGCCTGCTGCTGCTATTGTCGATGGGCTGGTCGTGCCTTT

Reverse complement sequence

AAAGGCACGACCAGCCCATCGACAATAGCAGCAGCAGGCTGAGCACTATGGTCGACGACATCAGCGGCTGCCAAAGCGGTGGCCTCCGTGCCAATGCTAG[T/C]
AGAGGCGTAGCTAACGGGGGATGGCCCCAAGAATACGGAGATCCGAGGCGGATTCATGGATCTCCTATCTCTCCACCCCTCTACCCTCTCGGTTCTCACT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.60%	41.10%	0.28%	0.00%	NA
All Indica	2759	71.20%	28.50%	0.33%	0.00%	NA
All Japonica	1512	30.00%	70.00%	0.00%	0.00%	NA
Aus	269	82.20%	17.50%	0.37%	0.00%	NA
Indica I	595	95.30%	4.70%	0.00%	0.00%	NA
Indica II	465	55.30%	43.40%	1.29%	0.00%	NA
Indica III	913	60.90%	39.00%	0.11%	0.00%	NA
Indica Intermediate	786	74.30%	25.40%	0.25%	0.00%	NA
Temperate Japonica	767	28.80%	71.20%	0.00%	0.00%	NA
Tropical Japonica	504	24.20%	75.80%	0.00%	0.00%	NA
Japonica Intermediate	241	45.60%	54.40%	0.00%	0.00%	NA
VI/Aromatic	96	89.60%	8.30%	2.08%	0.00%	NA
Intermediate	90	52.20%	46.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0807752750	A -> G	LOC_Os08g13060.1	downstream_gene_variant ; 3916.0bp to feature; MODIFIER	silent_mutation	Average:66.177; most accessible tissue: Zhenshan97 young leaf, score: 83.831	N	N	N	N
vg0807752750	A -> G	LOC_Os08g13050-LOC_Os08g13060	intergenic_region ; MODIFIER	silent_mutation	Average:66.177; most accessible tissue: Zhenshan97 young leaf, score: 83.831	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0807752750	NA	8.93E-06	mr1202	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807752750	NA	1.99E-06	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807752750	3.86E-06	3.86E-06	mr1171_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807752750	7.51E-06	7.51E-06	mr1311_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807752750	4.90E-06	4.90E-06	mr1329_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807752750	7.90E-06	7.90E-06	mr1652_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807752750	1.42E-06	1.42E-06	mr1674_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807752750	5.50E-06	5.50E-06	mr1688_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807752750	8.76E-06	8.76E-06	mr1697_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251