\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0807752750:

Variant ID: vg0807752750 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 7752750
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


AGTGAGAACCGAGAGGGTAGAGGGGTGGAGAGATAGGAGATCCATGAATCCGCCTCGGATCTCCGTATTCTTGGGGCCATCCCCCGTTAGCTACGCCTCT[A/G]
CTAGCATTGGCACGGAGGCCACCGCTTTGGCAGCCGCTGATGTCGTCGACCATAGTGCTCAGCCTGCTGCTGCTATTGTCGATGGGCTGGTCGTGCCTTT

Reverse complement sequence

AAAGGCACGACCAGCCCATCGACAATAGCAGCAGCAGGCTGAGCACTATGGTCGACGACATCAGCGGCTGCCAAAGCGGTGGCCTCCGTGCCAATGCTAG[T/C]
AGAGGCGTAGCTAACGGGGGATGGCCCCAAGAATACGGAGATCCGAGGCGGATTCATGGATCTCCTATCTCTCCACCCCTCTACCCTCTCGGTTCTCACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.60% 41.10% 0.28% 0.00% NA
All Indica  2759 71.20% 28.50% 0.33% 0.00% NA
All Japonica  1512 30.00% 70.00% 0.00% 0.00% NA
Aus  269 82.20% 17.50% 0.37% 0.00% NA
Indica I  595 95.30% 4.70% 0.00% 0.00% NA
Indica II  465 55.30% 43.40% 1.29% 0.00% NA
Indica III  913 60.90% 39.00% 0.11% 0.00% NA
Indica Intermediate  786 74.30% 25.40% 0.25% 0.00% NA
Temperate Japonica  767 28.80% 71.20% 0.00% 0.00% NA
Tropical Japonica  504 24.20% 75.80% 0.00% 0.00% NA
Japonica Intermediate  241 45.60% 54.40% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 8.30% 2.08% 0.00% NA
Intermediate  90 52.20% 46.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0807752750 A -> G LOC_Os08g13060.1 downstream_gene_variant ; 3916.0bp to feature; MODIFIER silent_mutation Average:66.177; most accessible tissue: Zhenshan97 young leaf, score: 83.831 N N N N
vg0807752750 A -> G LOC_Os08g13050-LOC_Os08g13060 intergenic_region ; MODIFIER silent_mutation Average:66.177; most accessible tissue: Zhenshan97 young leaf, score: 83.831 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0807752750 NA 8.93E-06 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807752750 NA 1.99E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807752750 3.86E-06 3.86E-06 mr1171_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807752750 7.51E-06 7.51E-06 mr1311_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807752750 4.90E-06 4.90E-06 mr1329_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807752750 7.90E-06 7.90E-06 mr1652_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807752750 1.42E-06 1.42E-06 mr1674_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807752750 5.50E-06 5.50E-06 mr1688_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807752750 8.76E-06 8.76E-06 mr1697_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251