\
| Variant ID: vg0807752750 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 7752750 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 86. )
AGTGAGAACCGAGAGGGTAGAGGGGTGGAGAGATAGGAGATCCATGAATCCGCCTCGGATCTCCGTATTCTTGGGGCCATCCCCCGTTAGCTACGCCTCT[A/G]
CTAGCATTGGCACGGAGGCCACCGCTTTGGCAGCCGCTGATGTCGTCGACCATAGTGCTCAGCCTGCTGCTGCTATTGTCGATGGGCTGGTCGTGCCTTT
AAAGGCACGACCAGCCCATCGACAATAGCAGCAGCAGGCTGAGCACTATGGTCGACGACATCAGCGGCTGCCAAAGCGGTGGCCTCCGTGCCAATGCTAG[T/C]
AGAGGCGTAGCTAACGGGGGATGGCCCCAAGAATACGGAGATCCGAGGCGGATTCATGGATCTCCTATCTCTCCACCCCTCTACCCTCTCGGTTCTCACT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.60% | 41.10% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 71.20% | 28.50% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 30.00% | 70.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 82.20% | 17.50% | 0.37% | 0.00% | NA |
| Indica I | 595 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 55.30% | 43.40% | 1.29% | 0.00% | NA |
| Indica III | 913 | 60.90% | 39.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 74.30% | 25.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 28.80% | 71.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 24.20% | 75.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 45.60% | 54.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 8.30% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 46.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0807752750 | A -> G | LOC_Os08g13060.1 | downstream_gene_variant ; 3916.0bp to feature; MODIFIER | silent_mutation | Average:66.177; most accessible tissue: Zhenshan97 young leaf, score: 83.831 | N | N | N | N |
| vg0807752750 | A -> G | LOC_Os08g13050-LOC_Os08g13060 | intergenic_region ; MODIFIER | silent_mutation | Average:66.177; most accessible tissue: Zhenshan97 young leaf, score: 83.831 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0807752750 | NA | 8.93E-06 | mr1202 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807752750 | NA | 1.99E-06 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807752750 | 3.86E-06 | 3.86E-06 | mr1171_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807752750 | 7.51E-06 | 7.51E-06 | mr1311_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807752750 | 4.90E-06 | 4.90E-06 | mr1329_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807752750 | 7.90E-06 | 7.90E-06 | mr1652_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807752750 | 1.42E-06 | 1.42E-06 | mr1674_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807752750 | 5.50E-06 | 5.50E-06 | mr1688_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807752750 | 8.76E-06 | 8.76E-06 | mr1697_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |